"""
The :mod:`scadnano` Python module is a library for describing synthetic DNA nanostructures
(e.g., DNA origami).
To install, type `pip install scadnano` at the command line;
more detailed installation instructions and troubleshooting tips are at the
`GitHub repository <https://github.com/UC-Davis-molecular-computing/scadnano-python-package#installation>`_.
The scadnano project is developed and maintained by the UC Davis Molecular Computing group.
Note that `cadnano <https://cadnano.org>`_ is a separate project,
developed and maintained by the `Douglas lab <https://bionano.ucsf.edu/>`_ at UCSF.
This module is used to write Python scripts creating files readable
by `scadnano <https://scadnano.org/>`_, a web application useful for displaying
and manually editing synthetic DNA nanostructures.
The purpose of this module is to help automate some of the task of creating DNA designs,
as well as making large-scale changes to them that are easier to describe programmatically than
to do by hand in scadnano.
If you find scadnano useful in a scientific project, please cite its associated paper:
| scadnano: A browser-based, scriptable tool for designing DNA nanostructures.
| David Doty, Benjamin L Lee, and Tristan Stérin.
| DNA 2020: *Proceedings of the 26th International Conference on DNA Computing and Molecular Programming*
| [ `paper <https://doi.org/10.4230/LIPIcs.DNA.2020.9>`_ | `BibTeX <https://web.cs.ucdavis.edu/~doty/papers/scadnano.bib>`_ ]
This document describes the API for the scadnano Python package,
see the `repository <https://github.com/UC-Davis-molecular-computing/scadnano-python-package>`_
for additional documentation, such as installation instructions.
There is separate documentation for the
`scadnano web interface <https://github.com/UC-Davis-molecular-computing/scadnano>`_.
This library uses typing hints from the Python typing library.
(https://docs.python.org/3/library/typing.html)
Each function and method indicate intended types of the parameters.
However, due to Python's design, these types are not enforced at runtime.
It is suggested to use a static analysis tool such as that provided by an IDE such as PyCharm
(https://www.jetbrains.com/pycharm/)
to see warnings when the typing rules are violated.
Such warnings probably indicate an erroneous usage.
Most of the classes in this module are Python dataclasses
(https://docs.python.org/3/library/dataclasses.html)
whose fields show up in the documentation.
Their types are listed in parentheses after the name of the class;
for example :any:`Color` has ``int`` fields :py:data:`Color.r`, :py:data:`Color.g`, :py:data:`Color.b`.
In general it is safe to read these fields directly, but not to write to them directly.
Setter methods (named ``set_<fieldname>``) are provided for fields where it makes sense to set it to another
value than it had originally.
However, due to Python naming conventions for dataclass fields and property setters,
it is not straightforward to enforce that the fields cannot be written,
so the user must take care not to set them.
"""
# needed to use forward annotations: https://docs.python.org/3/whatsnew/3.7.html#whatsnew37-pep563
from __future__ import annotations
__version__ = "0.20.1" # version line; WARNING: do not remove or change this line or comment
import collections
import dataclasses
from abc import abstractmethod, ABC, ABCMeta
import json
import enum
import itertools
import re
import math
from builtins import ValueError
from dataclasses import dataclass, field, InitVar, replace
from typing import (
Iterator,
Sequence,
Iterable,
Type,
cast,
Any,
TypeVar,
Callable,
AbstractSet,
Generator,
Literal,
)
from collections import defaultdict, OrderedDict, Counter
import sys
import os.path
from math import sqrt, sin, cos, pi
from random import randint
# we import like this so that we can use openpyxl.Workbook in the type hints, but still allow
# someone to use the library without having openpyxl installed
try:
# noinspection PyUnresolvedReferences
import openpyxl
except ImportError:
pass
default_scadnano_file_extension = "sc"
"""Default filename extension when writing a scadnano file."""
VStrands = dict[int, dict[str, Any]]
def _pairwise(iterable: Iterable) -> Iterable:
"""s -> (s0,s1), (s1,s2), (s2, s3), ..."""
a, b = itertools.tee(iterable)
next(b, None)
return zip(a, b)
# for putting evaluated expressions in docstrings
# https://stackoverflow.com/questions/10307696/how-to-put-a-variable-into-python-docstring
# not currently used since this way of implementing it is has a bug with using the .. codeblock:: directive
def _docstring_parameter(*sub: Any, **kwargs: Any) -> Any:
def dec(obj: Any) -> Any:
obj.__doc__ = obj.__doc__.format(*sub, **kwargs)
return obj
return dec
##############################################################################
# JSON serialization
# There are external libraries to handle JSON
# in Python, but I want this to be a simple, single-file library, so we just
# implement what we need below.
class _JSONSerializable(ABC):
@abstractmethod
def to_json_serializable(self, suppress_indent: bool = True, **kwargs: Any) -> Any:
raise NotImplementedError()
def _json_encode(obj: _JSONSerializable, suppress_indent: bool = True) -> str:
encoder = _SuppressableIndentEncoder if suppress_indent else json.JSONEncoder
serializable = obj.to_json_serializable(suppress_indent=suppress_indent)
return json.dumps(serializable, cls=encoder, indent=2)
class NoIndent:
# Value wrapper. Placing a value in this will stop it from being indented when converting to JSON
# using _SuppressableIndentEncoder
def __init__(self, value: Any) -> None:
self.value = value
class _SuppressableIndentEncoder(json.JSONEncoder):
def __init__(self, *args: Any, **kwargs: Any) -> None:
self.unique_id = 0
super(_SuppressableIndentEncoder, self).__init__(*args, **kwargs)
self.kwargs = dict(kwargs)
del self.kwargs["indent"]
self._replacement_map: dict[int, str] = {}
def default(self, obj: Any) -> Any:
if isinstance(obj, NoIndent):
# key = uuid.uuid1().hex # this caused problems with Brython.
key = self.unique_id
self.unique_id += 1
self._replacement_map[key] = json.dumps(obj.value, **self.kwargs)
return f"@@{key}@@"
else:
return super().default(obj)
def encode(self, obj: Any) -> Any:
result = super().encode(obj)
return re.sub(r'"@@(\d+)@@"', lambda m: self._replacement_map[int(m[1])], result)
#
# END JSON serialization
##############################################################################
##############################################################################
# Colors
# As with JSON serialization, there are external libraries to handle colors
# in Python, but I want this to be a simple, single-file library, so we just
# implement what we need below.
[docs]
@dataclass
class Color(_JSONSerializable):
r: int | None = None
"""
Red component: 0-255.
Optional if :data:`Color.hex_string` is given."""
g: int | None = None
"""Green component: 0-255.
Optional if :data:`Color.hex_string` is given."""
b: int | None = None
"""Blue component: 0-255.
Optional if :data:`Color.hex_string` is given."""
hex_string: InitVar[str | None] = None
"""Hex color preceded by # sign, e.g., "#ff0000" is red.
Optional if :py:data:`Color.r`, :py:data:`Color.g`, :py:data:`Color.b` are all given."""
def __post_init__(self, hex_string: str | None) -> None:
if hex_string is None:
assert self.r is not None and self.g is not None and self.b is not None
else:
assert self.r is None and self.g is None and self.b is None
hex_string = hex_string.lstrip("#")
self.r = int(hex_string[0:2], 16)
self.g = int(hex_string[2:4], 16)
self.b = int(hex_string[4:6], 16)
def to_json_serializable(self, suppress_indent: bool = True, **kwargs: Any) -> str:
# Return object representing this Color that is JSON serializable.
# return NoIndent(self.__dict__) if suppress_indent else self.__dict__
return f"#{self.r:02x}{self.g:02x}{self.b:02x}"
@staticmethod
def from_json(color_json: str | int | None) -> Color | None:
if color_json is None:
return None
color_str: str
if isinstance(color_json, int):
def decimal_int_to_hex(d: int) -> str:
return "#" + "{0:#08x}".format(d)[2:] # type: ignore
color_str = decimal_int_to_hex(color_json)
elif isinstance(color_json, str):
color_str = color_json
else:
raise IllegalDesignError(f"color must be a string or int, but it is a {type(color_json)}: {color_json}")
color = Color(hex_string=color_str)
return color
def to_cadnano_v2_int_hex(self) -> int:
return int(f"{self.r:02x}{self.g:02x}{self.b:02x}", 16)
@classmethod
def from_cadnano_v2_int_hex(cls, hex_int: int) -> "Color":
hex_str = "0x{:06x}".format(hex_int)
return Color(hex_string=hex_str[2:])
# https://medium.com/@rjurney/kellys-22-colours-of-maximum-contrast-58edb70c90d1
_kelly_colors = [ # 'F2F3F4', #almost white so it's no good
"222222",
"F3C300",
"875692",
"F38400",
"A1CAF1",
"BE0032",
"C2B280",
"848482",
"008856",
"E68FAC",
"0067A5",
"F99379",
"604E97",
"F6A600",
"B3446C",
"DCD300",
"882D17",
"8DB600",
"654522",
"E25822",
"2B3D26",
]
[docs]
class ColorCycler:
"""
Calling ``next(color_cycler)`` on a ColorCycler named ``color_cycler``
returns a the next :any:`Color` from a fixed size list,
cycling after reaching the end of the list.
To choose new colors, set ``color_cycler.colors`` to a new list of :any:`Color`'s.
"""
# These are copied from cadnano:
# https://github.com/sdouglas/cadnano2/blob/master/views/styles.py#L97
_colors: list[Color] = [
Color(50, 184, 108),
Color(204, 0, 0),
Color(247, 67, 8),
Color(247, 147, 30),
Color(170, 170, 0),
Color(87, 187, 0),
Color(0, 114, 0),
Color(3, 182, 162),
# Color(23, 0, 222), # don't like this because it looks too much like scaffold
Color(50, 0, 150), # this one is better contrast with scaffold
Color(184, 5, 108),
Color(51, 51, 51),
Color(115, 0, 222),
Color(136, 136, 136),
]
"""list of colors to cycle through."""
# _colors = [Color(hex_string=kelly_color) for kelly_color in _kelly_colors]
# """list of colors to cycle through."""
def __init__(self) -> None:
self._current_color_idx = 0
# random order
order = [3, 11, 0, 12, 8, 1, 10, 6, 5, 9, 4, 7, 2]
# order = range(len(self._colors))
colors_shuffled: list[Color] = list(self._colors)
for i, color in zip(order, self._colors):
colors_shuffled[i] = color
self._colors: list[Color] = colors_shuffled
def __iter__(self) -> "ColorCycler":
# need to make ColorCycler an iterator
return self
def __next__(self) -> Color:
color = self.current_color()
self._current_color_idx = (self._current_color_idx + 1) % len(self._colors)
return color
def current_color(self) -> Color:
return self._colors[self._current_color_idx]
def __hash__(self) -> int:
return hash(self.current_color())
def __eq__(self, other: Any) -> bool:
if not isinstance(other, ColorCycler):
return False
return self._current_color_idx == other._current_color_idx
def __str__(self) -> str:
return repr(self)
def __repr__(self) -> str:
return f"ColorCycler({self.current_color()})"
@property
def colors(self) -> list[Color]:
"""The colors that are cycled through when calling ``next()`` on some :any:`ColorCycler`."""
return list(self._colors)
@colors.setter
def colors(self, newcolors: Iterable[Color]) -> None:
self._colors = list(newcolors)
self._current_color_idx = 0
default_scaffold_color = Color(0, 102, 204)
"""Default color for scaffold strand(s)."""
default_strand_color = Color(0, 0, 0)
"""Default color for non-scaffold strand(s)."""
default_cadnano_strand_color = Color(hex_string="#BFBFBF")
#
# END Colors
##############################################################################
[docs]
@enum.unique
class Grid(str, enum.Enum):
"""
Represents default patterns for laying out helices in the side view.
Each :any:`Grid` except :py:data:`Grid.none` has an interpretation of a "grid position",
which is a 2D integer coordinate (`h`, `v`).
"""
square = "square"
"""
Square lattice.
Increasing `h` moves right and increasing `v` moves down.
(i.e., "computer screen coordinates" rather than Cartesian coordinates where positive `y` is up.)
"""
hex = "hex"
"""
Hexagonal lattice. Uses the *"odd-q horizontal layout"* coordinate system described here:
https://www.redblobgames.com/grids/hexagons/.
Incrementing `v` moves down.
Incrementing `h` moves down and to the right if `h` is even,
and moves up and to the right if `h` is odd.
"""
honeycomb = "honeycomb"
"""
Honeycomb lattice. This consists of all the hex lattice positions except where
honeycomb lattice disallows grid positions (`h`, `v`) with
`v` even and `h` a multiple of 3 or
`v` odd and `h` = 1 + a multiple of 3.
However, we use the same convention as cadnano for encoding honeycomb coordinates;
see `misc/cadnano-format-specs/v2.txt`.
That convention is different from simply excluding coordinates from the hex lattice.
"""
none = "none"
"""No fixed grid."""
# convenience names for users
square = Grid.square
hexagonal = Grid.hex # should not use identifier "hex" because that's a Python built-in function
honeycomb = Grid.honeycomb
##########################################################################
# constants
default_vendor_scale = "25nm"
default_vendor_purification = "STD"
def default_major_tick_distance(grid: Grid) -> int:
return 7 if grid in (Grid.hex, Grid.honeycomb) else 8
default_pitch: float = 0.0
default_roll: float = 0.0
default_yaw: float = 0.0
default_group_name = "default_group"
_floating_point_tolerance = 0.00000001
# XXX: code below related to SVG positions is not currently needed in the scripting library,
# but I want to make sure these conventions are documented somewhere, so they are just commented out for now.
#
# base_width_svg: float = 10.0
# """Width of a single base in the SVG main view of scadnano."""
#
# base_height_svg: float = 10.0
# """Height of a single base in the SVG main view of scadnano."""
#
# distance_between_helices_nm: float = 2.5
# """Distance between centers of helices in nanometers.
# See :py:data:`distance_between_helices_svg` for explanation of this value."""
#
# base_width_nm: float = 0.34
# """Width of a single DNA base in nanometers."""
#
# distance_between_helices_svg: float = base_width_svg * distance_between_helices_nm / base_width_nm
# """Distance between tops of two consecutive helices (using default positioning rules).
#
# This is set to (:const:`base_width_svg` * 2.5/0.34) based on the following calculation,
# to attempt to make the DNA structure appear to scale in 2D drawings:
# The width of one base pair of double-stranded DNA bp is 0.34 nm. In a DNA origami,
# AFM images let us estimate that the average distance between adjacent double helices is 2.5 nm.
# (A DNA double-helix is only 2 nm wide, but the helices electrostatically repel each other so the spacing
# in a DNA origami or an other DNA nanostructure with many parallel DNA helices---e.g., single-stranded tile
# lattices---is larger than 2 nm.)
# Thus the distance between the helices is 2.5/0.34 ~ 7.5 times the width of a single DNA base.
# """
DNA_base_wildcard: str = "?"
"""Symbol to insert when a DNA sequence has been assigned to a strand through complementarity, but
some regions of the strand are not bound to the strand that was just assigned. Also used in case the
DNA sequence assigned to a strand is too short; the sequence is padded with :any:`DNA_base_wildcard` to
make its length the same as the length of the strand."""
def _rotate_string(string: str, rotation: int) -> str:
rotation = rotation % len(string)
return string[rotation:] + string[:rotation]
[docs]
class M13Variant(enum.Enum):
"""
Variants of M13mp18 viral genome. "Standard" variant is p7249. Other variants are longer.
To create a string with the DNA sequence of one of these variants, call the function
:func:`m13`.
"""
p7249 = "p7249"
""""Standard" variant of M13mp18; 7249 bases long, available from, for example
https://www.tilibit.com/collections/scaffold-dna/products/single-stranded-scaffold-dna-type-p7249
https://www.neb.com/products/n4040-m13mp18-single-stranded-dna
http://www.bayoubiolabs.com/biochemicat/vectors/pUCM13/
""" # noqa
p7560 = "p7560"
"""Variant of M13mp18 that is 7560 bases long. Available from, for example
https://www.tilibit.com/collections/scaffold-dna/products/single-stranded-scaffold-dna-type-p7560
"""
p8064 = "p8064"
"""Variant of M13mp18 that is 8064 bases long. Available from, for example
https://www.tilibit.com/collections/scaffold-dna/products/single-stranded-scaffold-dna-type-p8064
"""
p8634 = "p8634"
"""Variant of M13mp18 that is 8634 bases long. At the time of this writing, not listed as available
from any biotech vender, but Tilibit will make it for you if you ask.
(https://www.tilibit.com/pages/contact-us)
"""
[docs]
def m13(rotation: int = 5587, variant: M13Variant = M13Variant.p7249) -> str:
"""
The M13mp18 DNA sequence (commonly called simply M13).
By default, starts from cyclic rotation 5587
(with 0-based indexing; commonly this is called rotation 5588, which assumes that indexing begins at 1),
as defined in
`GenBank <https://www.ncbi.nlm.nih.gov/nuccore/X02513.1>`_.
By default, returns the "standard" variant of consisting of 7249 bases, sold by companies such as
`Tilibit <https://cdn.shopify.com/s/files/1/1299/5863/files/Product_Sheet_single-stranded_scaffold_DNA_type_7249_M1-10.pdf?14656642867652657391>`_
and
`New England Biolabs <https://www.neb.com/~/media/nebus/page%20images/tools%20and%20resources/interactive%20tools/dna%20sequences%20and%20maps/m13mp18_map.pdf>`_.
The actual M13 DNA strand itself is circular,
so assigning this sequence to the scaffold :any:`Strand` in a :any:`Design`
means that the "5' end" of the scaffold :any:`Strand`
(which is a fiction since the actual circular DNA strand has no endpoint)
will have the sequence starting at position 5587 (if another value for `rotation` is not specified)
starting at the displayed 5' in scadnano, assigned until the displayed 3' end.
Assuming the displayed scaffold :any:`Strand` has length :math:`n < 7249`, then a loopout of length
:math:`7249 - n` consisting of the undisplayed bases will be present in the actual DNA structure.
For a more detailed discussion of why this particular rotation of M13 is chosen as the default,
see
`Supplementary Note S8 <http://www.dna.caltech.edu/Papers/DNAorigami-supp1.linux.pdf>`_
in
[`Folding DNA to create nanoscale shapes and patterns. Paul W. K. Rothemund, Nature 440:297-302 (2006) <http://www.nature.com/nature/journal/v440/n7082/abs/nature04586.html>`_].
:param rotation: rotation of circular strand. Valid values are 0 through length-1.
:param variant: variant of M13 strand to use
:return: M13 strand sequence
""" # noqa
seq = _m13_variants[variant]
return _rotate_string(seq, rotation)
_7249 = re.sub(
r"\s",
"",
"""
AATGCTACTACTATTAGTAGAATTGATGCCACCTTTTCAGCTCGCGCCCCAAATGAAAATATAGCTAAACAGGTTATTGACCATTTGCGAAATGTATCTA
ATGGTCAAACTAAATCTACTCGTTCGCAGAATTGGGAATCAACTGTTATATGGAATGAAACTTCCAGACACCGTACTTTAGTTGCATATTTAAAACATGT
TGAGCTACAGCATTATATTCAGCAATTAAGCTCTAAGCCATCCGCAAAAATGACCTCTTATCAAAAGGAGCAATTAAAGGTACTCTCTAATCCTGACCTG
TTGGAGTTTGCTTCCGGTCTGGTTCGCTTTGAAGCTCGAATTAAAACGCGATATTTGAAGTCTTTCGGGCTTCCTCTTAATCTTTTTGATGCAATCCGCT
TTGCTTCTGACTATAATAGTCAGGGTAAAGACCTGATTTTTGATTTATGGTCATTCTCGTTTTCTGAACTGTTTAAAGCATTTGAGGGGGATTCAATGAA
TATTTATGACGATTCCGCAGTATTGGACGCTATCCAGTCTAAACATTTTACTATTACCCCCTCTGGCAAAACTTCTTTTGCAAAAGCCTCTCGCTATTTT
GGTTTTTATCGTCGTCTGGTAAACGAGGGTTATGATAGTGTTGCTCTTACTATGCCTCGTAATTCCTTTTGGCGTTATGTATCTGCATTAGTTGAATGTG
GTATTCCTAAATCTCAACTGATGAATCTTTCTACCTGTAATAATGTTGTTCCGTTAGTTCGTTTTATTAACGTAGATTTTTCTTCCCAACGTCCTGACTG
GTATAATGAGCCAGTTCTTAAAATCGCATAAGGTAATTCACAATGATTAAAGTTGAAATTAAACCATCTCAAGCCCAATTTACTACTCGTTCTGGTGTTT
CTCGTCAGGGCAAGCCTTATTCACTGAATGAGCAGCTTTGTTACGTTGATTTGGGTAATGAATATCCGGTTCTTGTCAAGATTACTCTTGATGAAGGTCA
GCCAGCCTATGCGCCTGGTCTGTACACCGTTCATCTGTCCTCTTTCAAAGTTGGTCAGTTCGGTTCCCTTATGATTGACCGTCTGCGCCTCGTTCCGGCT
AAGTAACATGGAGCAGGTCGCGGATTTCGACACAATTTATCAGGCGATGATACAAATCTCCGTTGTACTTTGTTTCGCGCTTGGTATAATCGCTGGGGGT
CAAAGATGAGTGTTTTAGTGTATTCTTTTGCCTCTTTCGTTTTAGGTTGGTGCCTTCGTAGTGGCATTACGTATTTTACCCGTTTAATGGAAACTTCCTC
ATGAAAAAGTCTTTAGTCCTCAAAGCCTCTGTAGCCGTTGCTACCCTCGTTCCGATGCTGTCTTTCGCTGCTGAGGGTGACGATCCCGCAAAAGCGGCCT
TTAACTCCCTGCAAGCCTCAGCGACCGAATATATCGGTTATGCGTGGGCGATGGTTGTTGTCATTGTCGGCGCAACTATCGGTATCAAGCTGTTTAAGAA
ATTCACCTCGAAAGCAAGCTGATAAACCGATACAATTAAAGGCTCCTTTTGGAGCCTTTTTTTTGGAGATTTTCAACGTGAAAAAATTATTATTCGCAAT
TCCTTTAGTTGTTCCTTTCTATTCTCACTCCGCTGAAACTGTTGAAAGTTGTTTAGCAAAATCCCATACAGAAAATTCATTTACTAACGTCTGGAAAGAC
GACAAAACTTTAGATCGTTACGCTAACTATGAGGGCTGTCTGTGGAATGCTACAGGCGTTGTAGTTTGTACTGGTGACGAAACTCAGTGTTACGGTACAT
GGGTTCCTATTGGGCTTGCTATCCCTGAAAATGAGGGTGGTGGCTCTGAGGGTGGCGGTTCTGAGGGTGGCGGTTCTGAGGGTGGCGGTACTAAACCTCC
TGAGTACGGTGATACACCTATTCCGGGCTATACTTATATCAACCCTCTCGACGGCACTTATCCGCCTGGTACTGAGCAAAACCCCGCTAATCCTAATCCT
TCTCTTGAGGAGTCTCAGCCTCTTAATACTTTCATGTTTCAGAATAATAGGTTCCGAAATAGGCAGGGGGCATTAACTGTTTATACGGGCACTGTTACTC
AAGGCACTGACCCCGTTAAAACTTATTACCAGTACACTCCTGTATCATCAAAAGCCATGTATGACGCTTACTGGAACGGTAAATTCAGAGACTGCGCTTT
CCATTCTGGCTTTAATGAGGATTTATTTGTTTGTGAATATCAAGGCCAATCGTCTGACCTGCCTCAACCTCCTGTCAATGCTGGCGGCGGCTCTGGTGGT
GGTTCTGGTGGCGGCTCTGAGGGTGGTGGCTCTGAGGGTGGCGGTTCTGAGGGTGGCGGCTCTGAGGGAGGCGGTTCCGGTGGTGGCTCTGGTTCCGGTG
ATTTTGATTATGAAAAGATGGCAAACGCTAATAAGGGGGCTATGACCGAAAATGCCGATGAAAACGCGCTACAGTCTGACGCTAAAGGCAAACTTGATTC
TGTCGCTACTGATTACGGTGCTGCTATCGATGGTTTCATTGGTGACGTTTCCGGCCTTGCTAATGGTAATGGTGCTACTGGTGATTTTGCTGGCTCTAAT
TCCCAAATGGCTCAAGTCGGTGACGGTGATAATTCACCTTTAATGAATAATTTCCGTCAATATTTACCTTCCCTCCCTCAATCGGTTGAATGTCGCCCTT
TTGTCTTTGGCGCTGGTAAACCATATGAATTTTCTATTGATTGTGACAAAATAAACTTATTCCGTGGTGTCTTTGCGTTTCTTTTATATGTTGCCACCTT
TATGTATGTATTTTCTACGTTTGCTAACATACTGCGTAATAAGGAGTCTTAATCATGCCAGTTCTTTTGGGTATTCCGTTATTATTGCGTTTCCTCGGTT
TCCTTCTGGTAACTTTGTTCGGCTATCTGCTTACTTTTCTTAAAAAGGGCTTCGGTAAGATAGCTATTGCTATTTCATTGTTTCTTGCTCTTATTATTGG
GCTTAACTCAATTCTTGTGGGTTATCTCTCTGATATTAGCGCTCAATTACCCTCTGACTTTGTTCAGGGTGTTCAGTTAATTCTCCCGTCTAATGCGCTT
CCCTGTTTTTATGTTATTCTCTCTGTAAAGGCTGCTATTTTCATTTTTGACGTTAAACAAAAAATCGTTTCTTATTTGGATTGGGATAAATAATATGGCT
GTTTATTTTGTAACTGGCAAATTAGGCTCTGGAAAGACGCTCGTTAGCGTTGGTAAGATTCAGGATAAAATTGTAGCTGGGTGCAAAATAGCAACTAATC
TTGATTTAAGGCTTCAAAACCTCCCGCAAGTCGGGAGGTTCGCTAAAACGCCTCGCGTTCTTAGAATACCGGATAAGCCTTCTATATCTGATTTGCTTGC
TATTGGGCGCGGTAATGATTCCTACGATGAAAATAAAAACGGCTTGCTTGTTCTCGATGAGTGCGGTACTTGGTTTAATACCCGTTCTTGGAATGATAAG
GAAAGACAGCCGATTATTGATTGGTTTCTACATGCTCGTAAATTAGGATGGGATATTATTTTTCTTGTTCAGGACTTATCTATTGTTGATAAACAGGCGC
GTTCTGCATTAGCTGAACATGTTGTTTATTGTCGTCGTCTGGACAGAATTACTTTACCTTTTGTCGGTACTTTATATTCTCTTATTACTGGCTCGAAAAT
GCCTCTGCCTAAATTACATGTTGGCGTTGTTAAATATGGCGATTCTCAATTAAGCCCTACTGTTGAGCGTTGGCTTTATACTGGTAAGAATTTGTATAAC
GCATATGATACTAAACAGGCTTTTTCTAGTAATTATGATTCCGGTGTTTATTCTTATTTAACGCCTTATTTATCACACGGTCGGTATTTCAAACCATTAA
ATTTAGGTCAGAAGATGAAATTAACTAAAATATATTTGAAAAAGTTTTCTCGCGTTCTTTGTCTTGCGATTGGATTTGCATCAGCATTTACATATAGTTA
TATAACCCAACCTAAGCCGGAGGTTAAAAAGGTAGTCTCTCAGACCTATGATTTTGATAAATTCACTATTGACTCTTCTCAGCGTCTTAATCTAAGCTAT
CGCTATGTTTTCAAGGATTCTAAGGGAAAATTAATTAATAGCGACGATTTACAGAAGCAAGGTTATTCACTCACATATATTGATTTATGTACTGTTTCCA
TTAAAAAAGGTAATTCAAATGAAATTGTTAAATGTAATTAATTTTGTTTTCTTGATGTTTGTTTCATCATCTTCTTTTGCTCAGGTAATTGAAATGAATA
ATTCGCCTCTGCGCGATTTTGTAACTTGGTATTCAAAGCAATCAGGCGAATCCGTTATTGTTTCTCCCGATGTAAAAGGTACTGTTACTGTATATTCATC
TGACGTTAAACCTGAAAATCTACGCAATTTCTTTATTTCTGTTTTACGTGCAAATAATTTTGATATGGTAGGTTCTAACCCTTCCATTATTCAGAAGTAT
AATCCAAACAATCAGGATTATATTGATGAATTGCCATCATCTGATAATCAGGAATATGATGATAATTCCGCTCCTTCTGGTGGTTTCTTTGTTCCGCAAA
ATGATAATGTTACTCAAACTTTTAAAATTAATAACGTTCGGGCAAAGGATTTAATACGAGTTGTCGAATTGTTTGTAAAGTCTAATACTTCTAAATCCTC
AAATGTATTATCTATTGACGGCTCTAATCTATTAGTTGTTAGTGCTCCTAAAGATATTTTAGATAACCTTCCTCAATTCCTTTCAACTGTTGATTTGCCA
ACTGACCAGATATTGATTGAGGGTTTGATATTTGAGGTTCAGCAAGGTGATGCTTTAGATTTTTCATTTGCTGCTGGCTCTCAGCGTGGCACTGTTGCAG
GCGGTGTTAATACTGACCGCCTCACCTCTGTTTTATCTTCTGCTGGTGGTTCGTTCGGTATTTTTAATGGCGATGTTTTAGGGCTATCAGTTCGCGCATT
AAAGACTAATAGCCATTCAAAAATATTGTCTGTGCCACGTATTCTTACGCTTTCAGGTCAGAAGGGTTCTATCTCTGTTGGCCAGAATGTCCCTTTTATT
ACTGGTCGTGTGACTGGTGAATCTGCCAATGTAAATAATCCATTTCAGACGATTGAGCGTCAAAATGTAGGTATTTCCATGAGCGTTTTTCCTGTTGCAA
TGGCTGGCGGTAATATTGTTCTGGATATTACCAGCAAGGCCGATAGTTTGAGTTCTTCTACTCAGGCAAGTGATGTTATTACTAATCAAAGAAGTATTGC
TACAACGGTTAATTTGCGTGATGGACAGACTCTTTTACTCGGTGGCCTCACTGATTATAAAAACACTTCTCAGGATTCTGGCGTACCGTTCCTGTCTAAA
ATCCCTTTAATCGGCCTCCTGTTTAGCTCCCGCTCTGATTCTAACGAGGAAAGCACGTTATACGTGCTCGTCAAAGCAACCATAGTACGCGCCCTGTAGC
GGCGCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGCGTGACCGCTACACTTGCCAGCGCCCTAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTTTC
TCGCCACGTTCGCCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGCTCCCTTTAGGGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCAAAAAACTTGA
TTTGGGTGATGGTTCACGTAGTGGGCCATCGCCCTGATAGACGGTTTTTCGCCCTTTGACGTTGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAA
ACTGGAACAACACTCAACCCTATCTCGGGCTATTCTTTTGATTTATAAGGGATTTTGCCGATTTCGGAACCACCATCAAACAGGATTTTCGCCTGCTGGG
GCAAACCAGCGTGGACCGCTTGCTGCAACTCTCTCAGGGCCAGGCGGTGAAGGGCAATCAGCTGTTGCCCGTCTCACTGGTGAAAAGAAAAACCACCCTG
GCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAAC
GCAATTAATGTGAGTTAGCTCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAACAATTTC
ACACAGGAAACAGCTATGACCATGATTACGAATTCGAGCTCGGTACCCGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGGCACTGGCCGTCG
TTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCG
CACCGATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGGCGCTTTGCCTGGTTTCCGGCACCAGAAGCGGTGCCGGAAAGCTGGCTGGAGTGC
GATCTTCCTGAGGCCGATACTGTCGTCGTCCCCTCAAACTGGCAGATGCACGGTTACGATGCGCCCATCTACACCAACGTGACCTATCCCATTACGGTCA
ATCCGCCGTTTGTTCCCACGGAGAATCCGACGGGTTGTTACTCGCTCACATTTAATGTTGATGAAAGCTGGCTACAGGAAGGCCAGACGCGAATTATTTT
TGATGGCGTTCCTATTGGTTAAAAAATGAGCTGATTTAACAAAAATTTAATGCGAATTTTAACAAAATATTAACGTTTACAATTTAAATATTTGCTTATA
CAATCTTCCTGTTTTTGGGGCTTTTCTGATTATCAACCGGGGTACATATGATTGACATGCTAGTTTTACGATTACCGTTCATCGATTCTCTTGTTTGCTC
CAGACTCTCAGGCAATGACCTGATAGCCTTTGTAGATCTCTCAAAAATAGCTACCCTCTCCGGCATTAATTTATCAGCTAGAACGGTTGAATATCATATT
GATGGTGATTTGACTGTCTCCGGCCTTTCTCACCCTTTTGAATCTTTACCTACACATTACTCAGGCATTGCATTTAAAATATATGAGGGTTCTAAAAATT
TTTATCCTTGCGTTGAAATAAAGGCTTCTCCCGCAAAAGTATTACAGGGTCATAATGTTTTTGGTACAACCGATTTAGCTTTATGCTCTGAGGCTTTATT
GCTTAATTTTGCTAATTCTTTGCCTTGCCTGTATGATTTATTGGATGTT
""",
)
_7560 = re.sub(
r"\s",
"",
"""
AGCTTGGCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGC
GTAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGGCGCTTTGCCTGGTTTCCGGCACCAGAAGCGGTGCC
GGAAAGCTGGCTGGAGTGCGATCTTCCTGAGGCCGATACTGTCGTCGTCCCCTCAAACTGGCAGATGCACGGTTACGATGCGCCCATCTACACCAACGTG
ACCTATCCCATTACGGTCAATCCGCCGTTTGTTCCCACGGAGAATCCGACGGGTTGTTACTCGCTCACATTTAATGTTGATGAAAGCTGGCTACAGGAAG
GCCAGACGCGAATTATTTTTGATGGCGTTCCTATTGGTTAAAAAATGAGCTGATTTAACAAAAATTTAATGCGAATTTTAACAAAATATTAACGTTTACA
ATTTAAATATTTGCTTATACAATCTTCCTGTTTTTGGGGCTTTTCTGATTATCAACCGGGGTACATATGATTGACATGCTAGTTTTACGATTACCGTTCA
TCGATTCTCTTGTTTGCTCCAGACTCTCAGGCAATGACCTGATAGCCTTTGTAGATCTCTCAAAAATAGCTACCCTCTCCGGCATTAATTTATCAGCTAG
AACGGTTGAATATCATATTGATGGTGATTTGACTGTCTCCGGCCTTTCTCACCCTTTTGAATCTTTACCTACACATTACTCAGGCATTGCATTTAAAATA
TATGAGGGTTCTAAAAATTTTTATCCTTGCGTTGAAATAAAGGCTTCTCCCGCAAAAGTATTACAGGGTCATAATGTTTTTGGTACAACCGATTTAGCTT
TATGCTCTGAGGCTTTATTGCTTAATTTTGCTAATTCTTTGCCTTGCCTGTATGATTTATTGGATGTTAATGCTACTACTATTAGTAGAATTGATGCCAC
CTTTTCAGCTCGCGCCCCAAATGAAAATATAGCTAAACAGGTTATTGACCATTTGCGAAATGTATCTAATGGTCAAACTAAATCTACTCGTTCGCAGAAT
TGGGAATCAACTGTTATATGGAATGAAACTTCCAGACACCGTACTTTAGTTGCATATTTAAAACATGTTGAGCTACAGCATTATATTCAGCAATTAAGCT
CTAAGCCATCCGCAAAAATGACCTCTTATCAAAAGGAGCAATTAAAGGTACTCTCTAATCCTGACCTGTTGGAGTTTGCTTCCGGTCTGGTTCGCTTTGA
AGCTCGAATTAAAACGCGATATTTGAAGTCTTTCGGGCTTCCTCTTAATCTTTTTGATGCAATCCGCTTTGCTTCTGACTATAATAGTCAGGGTAAAGAC
CTGATTTTTGATTTATGGTCATTCTCGTTTTCTGAACTGTTTAAAGCATTTGAGGGGGATTCAATGAATATTTATGACGATTCCGCAGTATTGGACGCTA
TCCAGTCTAAACATTTTACTATTACCCCCTCTGGCAAAACTTCTTTTGCAAAAGCCTCTCGCTATTTTGGTTTTTATCGTCGTCTGGTAAACGAGGGTTA
TGATAGTGTTGCTCTTACTATGCCTCGTAATTCCTTTTGGCGTTATGTATCTGCATTAGTTGAATGTGGTATTCCTAAATCTCAACTGATGAATCTTTCT
ACCTGTAATAATGTTGTTCCGTTAGTTCGTTTTATTAACGTAGATTTTTCTTCCCAACGTCCTGACTGGTATAATGAGCCAGTTCTTAAAATCGCATAAG
GTAATTCACAATGATTAAAGTTGAAATTAAACCATCTCAAGCCCAATTTACTACTCGTTCTGGTGTTTCTCGTCAGGGCAAGCCTTATTCACTGAATGAG
CAGCTTTGTTACGTTGATTTGGGTAATGAATATCCGGTTCTTGTCAAGATTACTCTTGATGAAGGTCAGCCAGCCTATGCGCCTGGTCTGTACACCGTTC
ATCTGTCCTCTTTCAAAGTTGGTCAGTTCGGTTCCCTTATGATTGACCGTCTGCGCCTCGTTCCGGCTAAGTAACATGGAGCAGGTCGCGGATTTCGACA
CAATTTATCAGGCGATGATACAAATCTCCGTTGTACTTTGTTTCGCGCTTGGTATAATCGCTGGGGGTCAAAGATGAGTGTTTTAGTGTATTCTTTTGCC
TCTTTCGTTTTAGGTTGGTGCCTTCGTAGTGGCATTACGTATTTTACCCGTTTAATGGAAACTTCCTCATGAAAAAGTCTTTAGTCCTCAAAGCCTCTGT
AGCCGTTGCTACCCTCGTTCCGATGCTGTCTTTCGCTGCTGAGGGTGACGATCCCGCAAAAGCGGCCTTTAACTCCCTGCAAGCCTCAGCGACCGAATAT
ATCGGTTATGCGTGGGCGATGGTTGTTGTCATTGTCGGCGCAACTATCGGTATCAAGCTGTTTAAGAAATTCACCTCGAAAGCAAGCTGATAAACCGATA
CAATTAAAGGCTCCTTTTGGAGCCTTTTTTTTGGAGATTTTCAACGTGAAAAAATTATTATTCGCAATTCCTTTAGTTGTTCCTTTCTATTCTCACTCCG
CTGAAACTGTTGAAAGTTGTTTAGCAAAATCCCATACAGAAAATTCATTTACTAACGTCTGGAAAGACGACAAAACTTTAGATCGTTACGCTAACTATGA
GGGCTGTCTGTGGAATGCTACAGGCGTTGTAGTTTGTACTGGTGACGAAACTCAGTGTTACGGTACATGGGTTCCTATTGGGCTTGCTATCCCTGAAAAT
GAGGGTGGTGGCTCTGAGGGTGGCGGTTCTGAGGGTGGCGGTTCTGAGGGTGGCGGTACTAAACCTCCTGAGTACGGTGATACACCTATTCCGGGCTATA
CTTATATCAACCCTCTCGACGGCACTTATCCGCCTGGTACTGAGCAAAACCCCGCTAATCCTAATCCTTCTCTTGAGGAGTCTCAGCCTCTTAATACTTT
CATGTTTCAGAATAATAGGTTCCGAAATAGGCAGGGGGCATTAACTGTTTATACGGGCACTGTTACTCAAGGCACTGACCCCGTTAAAACTTATTACCAG
TACACTCCTGTATCATCAAAAGCCATGTATGACGCTTACTGGAACGGTAAATTCAGAGACTGCGCTTTCCATTCTGGCTTTAATGAGGATTTATTTGTTT
GTGAATATCAAGGCCAATCGTCTGACCTGCCTCAACCTCCTGTCAATGCTGGCGGCGGCTCTGGTGGTGGTTCTGGTGGCGGCTCTGAGGGTGGTGGCTC
TGAGGGTGGCGGTTCTGAGGGTGGCGGCTCTGAGGGAGGCGGTTCCGGTGGTGGCTCTGGTTCCGGTGATTTTGATTATGAAAAGATGGCAAACGCTAAT
AAGGGGGCTATGACCGAAAATGCCGATGAAAACGCGCTACAGTCTGACGCTAAAGGCAAACTTGATTCTGTCGCTACTGATTACGGTGCTGCTATCGATG
GTTTCATTGGTGACGTTTCCGGCCTTGCTAATGGTAATGGTGCTACTGGTGATTTTGCTGGCTCTAATTCCCAAATGGCTCAAGTCGGTGACGGTGATAA
TTCACCTTTAATGAATAATTTCCGTCAATATTTACCTTCCCTCCCTCAATCGGTTGAATGTCGCCCTTTTGTCTTTGGCGCTGGTAAACCATATGAATTT
TCTATTGATTGTGACAAAATAAACTTATTCCGTGGTGTCTTTGCGTTTCTTTTATATGTTGCCACCTTTATGTATGTATTTTCTACGTTTGCTAACATAC
TGCGTAATAAGGAGTCTTAATCATGCCAGTTCTTTTGGGTATTCCGTTATTATTGCGTTTCCTCGGTTTCCTTCTGGTAACTTTGTTCGGCTATCTGCTT
ACTTTTCTTAAAAAGGGCTTCGGTAAGATAGCTATTGCTATTTCATTGTTTCTTGCTCTTATTATTGGGCTTAACTCAATTCTTGTGGGTTATCTCTCTG
ATATTAGCGCTCAATTACCCTCTGACTTTGTTCAGGGTGTTCAGTTAATTCTCCCGTCTAATGCGCTTCCCTGTTTTTATGTTATTCTCTCTGTAAAGGC
TGCTATTTTCATTTTTGACGTTAAACAAAAAATCGTTTCTTATTTGGATTGGGATAAATAATATGGCTGTTTATTTTGTAACTGGCAAATTAGGCTCTGG
AAAGACGCTCGTTAGCGTTGGTAAGATTCAGGATAAAATTGTAGCTGGGTGCAAAATAGCAACTAATCTTGATTTAAGGCTTCAAAACCTCCCGCAAGTC
GGGAGGTTCGCTAAAACGCCTCGCGTTCTTAGAATACCGGATAAGCCTTCTATATCTGATTTGCTTGCTATTGGGCGCGGTAATGATTCCTACGATGAAA
ATAAAAACGGCTTGCTTGTTCTCGATGAGTGCGGTACTTGGTTTAATACCCGTTCTTGGAATGATAAGGAAAGACAGCCGATTATTGATTGGTTTCTACA
TGCTCGTAAATTAGGATGGGATATTATTTTTCTTGTTCAGGACTTATCTATTGTTGATAAACAGGCGCGTTCTGCATTAGCTGAACATGTTGTTTATTGT
CGTCGTCTGGACAGAATTACTTTACCTTTTGTCGGTACTTTATATTCTCTTATTACTGGCTCGAAAATGCCTCTGCCTAAATTACATGTTGGCGTTGTTA
AATATGGCGATTCTCAATTAAGCCCTACTGTTGAGCGTTGGCTTTATACTGGTAAGAATTTGTATAACGCATATGATACTAAACAGGCTTTTTCTAGTAA
TTATGATTCCGGTGTTTATTCTTATTTAACGCCTTATTTATCACACGGTCGGTATTTCAAACCATTAAATTTAGGTCAGAAGATGAAATTAACTAAAATA
TATTTGAAAAAGTTTTCTCGCGTTCTTTGTCTTGCGATTGGATTTGCATCAGCATTTACATATAGTTATATAACCCAACCTAAGCCGGAGGTTAAAAAGG
TAGTCTCTCAGACCTATGATTTTGATAAATTCACTATTGACTCTTCTCAGCGTCTTAATCTAAGCTATCGCTATGTTTTCAAGGATTCTAAGGGAAAATT
AATTAATAGCGACGATTTACAGAAGCAAGGTTATTCACTCACATATATTGATTTATGTACTGTTTCCATTAAAAAAGGTAATTCAAATGAAATTGTTAAA
TGTAATTAATTTTGTTTTCTTGATGTTTGTTTCATCATCTTCTTTTGCTCAGGTAATTGAAATGAATAATTCGCCTCTGCGCGATTTTGTAACTTGGTAT
TCAAAGCAATCAGGCGAATCCGTTATTGTTTCTCCCGATGTAAAAGGTACTGTTACTGTATATTCATCTGACGTTAAACCTGAAAATCTACGCAATTTCT
TTATTTCTGTTTTACGTGCAAATAATTTTGATATGGTAGGTTCTAACCCTTCCATTATTCAGAAGTATAATCCAAACAATCAGGATTATATTGATGAATT
GCCATCATCTGATAATCAGGAATATGATGATAATTCCGCTCCTTCTGGTGGTTTCTTTGTTCCGCAAAATGATAATGTTACTCAAACTTTTAAAATTAAT
AACGTTCGGGCAAAGGATTTAATACGAGTTGTCGAATTGTTTGTAAAGTCTAATACTTCTAAATCCTCAAATGTATTATCTATTGACGGCTCTAATCTAT
TAGTTGTTAGTGCTCCTAAAGATATTTTAGATAACCTTCCTCAATTCCTTTCAACTGTTGATTTGCCAACTGACCAGATATTGATTGAGGGTTTGATATT
TGAGGTTCAGCAAGGTGATGCTTTAGATTTTTCATTTGCTGCTGGCTCTCAGCGTGGCACTGTTGCAGGCGGTGTTAATACTGACCGCCTCACCTCTGTT
TTATCTTCTGCTGGTGGTTCGTTCGGTATTTTTAATGGCGATGTTTTAGGGCTATCAGTTCGCGCATTAAAGACTAATAGCCATTCAAAAATATTGTCTG
TGCCACGTATTCTTACGCTTTCAGGTCAGAAGGGTTCTATCTCTGTTGGCCAGAATGTCCCTTTTATTACTGGTCGTGTGACTGGTGAATCTGCCAATGT
AAATAATCCATTTCAGACGATTGAGCGTCAAAATGTAGGTATTTCCATGAGCGTTTTTCCTGTTGCAATGGCTGGCGGTAATATTGTTCTGGATATTACC
AGCAAGGCCGATAGTTTGAGTTCTTCTACTCAGGCAAGTGATGTTATTACTAATCAAAGAAGTATTGCTACAACGGTTAATTTGCGTGATGGACAGACTC
TTTTACTCGGTGGCCTCACTGATTATAAAAACACTTCTCAGGATTCTGGCGTACCGTTCCTGTCTAAAATCCCTTTAATCGGCCTCCTGTTTAGCTCCCG
CTCTGATTCTAACGAGGAAAGCACGTTATACGTGCTCGTCAAAGCAACCATAGTACGCGCCCTGTAGCGGCGCATTAAGCGCGGCGGGTGTGGTGGTTAC
GCGCAGCGTGACCGCTACACTTGCCAGCGCCCTAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCCCGTCAAGCT
CTAAATCGGGGGCTCCCTTTAGGGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCAAAAAACTTGATTTGGGTGATGGTTCACGTAGTGGGCCATCGC
CCTGATAGACGGTTTTTCGCCCTTTGACGTTGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAAACTGGAACAACACTCAACCCTATCTCGGGCTA
TTCTTTTGATTTATAAGGGATTTTGCCGATTTCGGAACCACCATCAAACAGGATTTTCGCCTGCTGGGGCAAACCAGCGTGGACCGCTTGCTGCAACTCT
CTCAGGGCCAGGCGGTGAAGGGCAATCAGCTGTTGCCCGTCTCACTGGTGAAAAGAAAAACCACCCTGGCGCCCAATACGCAAACCGCCTCTCCCCGCGC
GTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATGTGAGTTAGCTCACTCATTAGGC
ACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCTATGACCATGATTACGAA
TTCGAGCTCGGTACCCGGGGATCCTCCGTCTTTATCGAGGTAACAAGCACCACGTAGCTTAAGCCCTGTTTACTCATTACACCAACCAGGAGGTCAGAGT
TCGGAGAAATGATTTATGTGAAATGCGTCAGCCGATTCAAGGCCCCTATATTCGTGCCCACCGACGAGTTGCTTACAGATGGCAGGGCCGCACTGTCGGT
ATCATAGAGTCACTCCAGGGCGAGCGTAAATAGATTAGAAGCGGGGTTATTTTGGCGGGACATTGTCATAAGGTTGACAATTCAGCACTAAGGACACTTA
AGTCGTGCGCATGAATTCACAACCACTTAGAAGAACATCCACCCTGGCTTCTCCTGAGAA
""",
)
_8064 = re.sub(
r"\s",
"",
"""
GGCAATGACCTGATAGCCTTTGTAGATCTCTCAAAAATAGCTACCCTCTCCGGCATTAATTTATCAGCTAGAACGGTTGAATATCATATTGATGGTGATT
TGACTGTCTCCGGCCTTTCTCACCCTTTTGAATCTTTACCTACACATTACTCAGGCATTGCATTTAAAATATATGAGGGTTCTAAAAATTTTTATCCTTG
CGTTGAAATAAAGGCTTCTCCCGCAAAAGTATTACAGGGTCATAATGTTTTTGGTACAACCGATTTAGCTTTATGCTCTGAGGCTTTATTGCTTAATTTT
GCTAATTCTTTGCCTTGCCTGTATGATTTATTGGATGTTAATGCTACTACTATTAGTAGAATTGATGCCACCTTTTCAGCTCGCGCCCCAAATGAAAATA
TAGCTAAACAGGTTATTGACCATTTGCGAAATGTATCTAATGGTCAAACTAAATCTACTCGTTCGCAGAATTGGGAATCAACTGTTATATGGAATGAAAC
TTCCAGACACCGTACTTTAGTTGCATATTTAAAACATGTTGAGCTACAGCATTATATTCAGCAATTAAGCTCTAAGCCATCCGCAAAAATGACCTCTTAT
CAAAAGGAGCAATTAAAGGTACTCTCTAATCCTGACCTGTTGGAGTTTGCTTCCGGTCTGGTTCGCTTTGAAGCTCGAATTAAAACGCGATATTTGAAGT
CTTTCGGGCTTCCTCTTAATCTTTTTGATGCAATCCGCTTTGCTTCTGACTATAATAGTCAGGGTAAAGACCTGATTTTTGATTTATGGTCATTCTCGTT
TTCTGAACTGTTTAAAGCATTTGAGGGGGATTCAATGAATATTTATGACGATTCCGCAGTATTGGACGCTATCCAGTCTAAACATTTTACTATTACCCCC
TCTGGCAAAACTTCTTTTGCAAAAGCCTCTCGCTATTTTGGTTTTTATCGTCGTCTGGTAAACGAGGGTTATGATAGTGTTGCTCTTACTATGCCTCGTA
ATTCCTTTTGGCGTTATGTATCTGCATTAGTTGAATGTGGTATTCCTAAATCTCAACTGATGAATCTTTCTACCTGTAATAATGTTGTTCCGTTAGTTCG
TTTTATTAACGTAGATTTTTCTTCCCAACGTCCTGACTGGTATAATGAGCCAGTTCTTAAAATCGCATAAGGTAATTCACAATGATTAAAGTTGAAATTA
AACCATCTCAAGCCCAATTTACTACTCGTTCTGGTGTTTCTCGTCAGGGCAAGCCTTATTCACTGAATGAGCAGCTTTGTTACGTTGATTTGGGTAATGA
ATATCCGGTTCTTGTCAAGATTACTCTTGATGAAGGTCAGCCAGCCTATGCGCCTGGTCTGTACACCGTTCATCTGTCCTCTTTCAAAGTTGGTCAGTTC
GGTTCCCTTATGATTGACCGTCTGCGCCTCGTTCCGGCTAAGTAACATGGAGCAGGTCGCGGATTTCGACACAATTTATCAGGCGATGATACAAATCTCC
GTTGTACTTTGTTTCGCGCTTGGTATAATCGCTGGGGGTCAAAGATGAGTGTTTTAGTGTATTCTTTTGCCTCTTTCGTTTTAGGTTGGTGCCTTCGTAG
TGGCATTACGTATTTTACCCGTTTAATGGAAACTTCCTCATGAAAAAGTCTTTAGTCCTCAAAGCCTCTGTAGCCGTTGCTACCCTCGTTCCGATGCTGT
CTTTCGCTGCTGAGGGTGACGATCCCGCAAAAGCGGCCTTTAACTCCCTGCAAGCCTCAGCGACCGAATATATCGGTTATGCGTGGGCGATGGTTGTTGT
CATTGTCGGCGCAACTATCGGTATCAAGCTGTTTAAGAAATTCACCTCGAAAGCAAGCTGATAAACCGATACAATTAAAGGCTCCTTTTGGAGCCTTTTT
TTTGGAGATTTTCAACGTGAAAAAATTATTATTCGCAATTCCTTTAGTTGTTCCTTTCTATTCTCACTCCGCTGAAACTGTTGAAAGTTGTTTAGCAAAA
TCCCATACAGAAAATTCATTTACTAACGTCTGGAAAGACGACAAAACTTTAGATCGTTACGCTAACTATGAGGGCTGTCTGTGGAATGCTACAGGCGTTG
TAGTTTGTACTGGTGACGAAACTCAGTGTTACGGTACATGGGTTCCTATTGGGCTTGCTATCCCTGAAAATGAGGGTGGTGGCTCTGAGGGTGGCGGTTC
TGAGGGTGGCGGTTCTGAGGGTGGCGGTACTAAACCTCCTGAGTACGGTGATACACCTATTCCGGGCTATACTTATATCAACCCTCTCGACGGCACTTAT
CCGCCTGGTACTGAGCAAAACCCCGCTAATCCTAATCCTTCTCTTGAGGAGTCTCAGCCTCTTAATACTTTCATGTTTCAGAATAATAGGTTCCGAAATA
GGCAGGGGGCATTAACTGTTTATACGGGCACTGTTACTCAAGGCACTGACCCCGTTAAAACTTATTACCAGTACACTCCTGTATCATCAAAAGCCATGTA
TGACGCTTACTGGAACGGTAAATTCAGAGACTGCGCTTTCCATTCTGGCTTTAATGAGGATTTATTTGTTTGTGAATATCAAGGCCAATCGTCTGACCTG
CCTCAACCTCCTGTCAATGCTGGCGGCGGCTCTGGTGGTGGTTCTGGTGGCGGCTCTGAGGGTGGTGGCTCTGAGGGTGGCGGTTCTGAGGGTGGCGGCT
CTGAGGGAGGCGGTTCCGGTGGTGGCTCTGGTTCCGGTGATTTTGATTATGAAAAGATGGCAAACGCTAATAAGGGGGCTATGACCGAAAATGCCGATGA
AAACGCGCTACAGTCTGACGCTAAAGGCAAACTTGATTCTGTCGCTACTGATTACGGTGCTGCTATCGATGGTTTCATTGGTGACGTTTCCGGCCTTGCT
AATGGTAATGGTGCTACTGGTGATTTTGCTGGCTCTAATTCCCAAATGGCTCAAGTCGGTGACGGTGATAATTCACCTTTAATGAATAATTTCCGTCAAT
ATTTACCTTCCCTCCCTCAATCGGTTGAATGTCGCCCTTTTGTCTTTGGCGCTGGTAAACCATATGAATTTTCTATTGATTGTGACAAAATAAACTTATT
CCGTGGTGTCTTTGCGTTTCTTTTATATGTTGCCACCTTTATGTATGTATTTTCTACGTTTGCTAACATACTGCGTAATAAGGAGTCTTAATCATGCCAG
TTCTTTTGGGTATTCCGTTATTATTGCGTTTCCTCGGTTTCCTTCTGGTAACTTTGTTCGGCTATCTGCTTACTTTTCTTAAAAAGGGCTTCGGTAAGAT
AGCTATTGCTATTTCATTGTTTCTTGCTCTTATTATTGGGCTTAACTCAATTCTTGTGGGTTATCTCTCTGATATTAGCGCTCAATTACCCTCTGACTTT
GTTCAGGGTGTTCAGTTAATTCTCCCGTCTAATGCGCTTCCCTGTTTTTATGTTATTCTCTCTGTAAAGGCTGCTATTTTCATTTTTGACGTTAAACAAA
AAATCGTTTCTTATTTGGATTGGGATAAATAATATGGCTGTTTATTTTGTAACTGGCAAATTAGGCTCTGGAAAGACGCTCGTTAGCGTTGGTAAGATTC
AGGATAAAATTGTAGCTGGGTGCAAAATAGCAACTAATCTTGATTTAAGGCTTCAAAACCTCCCGCAAGTCGGGAGGTTCGCTAAAACGCCTCGCGTTCT
TAGAATACCGGATAAGCCTTCTATATCTGATTTGCTTGCTATTGGGCGCGGTAATGATTCCTACGATGAAAATAAAAACGGCTTGCTTGTTCTCGATGAG
TGCGGTACTTGGTTTAATACCCGTTCTTGGAATGATAAGGAAAGACAGCCGATTATTGATTGGTTTCTACATGCTCGTAAATTAGGATGGGATATTATTT
TTCTTGTTCAGGACTTATCTATTGTTGATAAACAGGCGCGTTCTGCATTAGCTGAACATGTTGTTTATTGTCGTCGTCTGGACAGAATTACTTTACCTTT
TGTCGGTACTTTATATTCTCTTATTACTGGCTCGAAAATGCCTCTGCCTAAATTACATGTTGGCGTTGTTAAATATGGCGATTCTCAATTAAGCCCTACT
GTTGAGCGTTGGCTTTATACTGGTAAGAATTTGTATAACGCATATGATACTAAACAGGCTTTTTCTAGTAATTATGATTCCGGTGTTTATTCTTATTTAA
CGCCTTATTTATCACACGGTCGGTATTTCAAACCATTAAATTTAGGTCAGAAGATGAAATTAACTAAAATATATTTGAAAAAGTTTTCTCGCGTTCTTTG
TCTTGCGATTGGATTTGCATCAGCATTTACATATAGTTATATAACCCAACCTAAGCCGGAGGTTAAAAAGGTAGTCTCTCAGACCTATGATTTTGATAAA
TTCACTATTGACTCTTCTCAGCGTCTTAATCTAAGCTATCGCTATGTTTTCAAGGATTCTAAGGGAAAATTAATTAATAGCGACGATTTACAGAAGCAAG
GTTATTCACTCACATATATTGATTTATGTACTGTTTCCATTAAAAAAGGTAATTCAAATGAAATTGTTAAATGTAATTAATTTTGTTTTCTTGATGTTTG
TTTCATCATCTTCTTTTGCTCAGGTAATTGAAATGAATAATTCGCCTCTGCGCGATTTTGTAACTTGGTATTCAAAGCAATCAGGCGAATCCGTTATTGT
TTCTCCCGATGTAAAAGGTACTGTTACTGTATATTCATCTGACGTTAAACCTGAAAATCTACGCAATTTCTTTATTTCTGTTTTACGTGCAAATAATTTT
GATATGGTAGGTTCTAACCCTTCCATTATTCAGAAGTATAATCCAAACAATCAGGATTATATTGATGAATTGCCATCATCTGATAATCAGGAATATGATG
ATAATTCCGCTCCTTCTGGTGGTTTCTTTGTTCCGCAAAATGATAATGTTACTCAAACTTTTAAAATTAATAACGTTCGGGCAAAGGATTTAATACGAGT
TGTCGAATTGTTTGTAAAGTCTAATACTTCTAAATCCTCAAATGTATTATCTATTGACGGCTCTAATCTATTAGTTGTTAGTGCTCCTAAAGATATTTTA
GATAACCTTCCTCAATTCCTTTCAACTGTTGATTTGCCAACTGACCAGATATTGATTGAGGGTTTGATATTTGAGGTTCAGCAAGGTGATGCTTTAGATT
TTTCATTTGCTGCTGGCTCTCAGCGTGGCACTGTTGCAGGCGGTGTTAATACTGACCGCCTCACCTCTGTTTTATCTTCTGCTGGTGGTTCGTTCGGTAT
TTTTAATGGCGATGTTTTAGGGCTATCAGTTCGCGCATTAAAGACTAATAGCCATTCAAAAATATTGTCTGTGCCACGTATTCTTACGCTTTCAGGTCAG
AAGGGTTCTATCTCTGTTGGCCAGAATGTCCCTTTTATTACTGGTCGTGTGACTGGTGAATCTGCCAATGTAAATAATCCATTTCAGACGATTGAGCGTC
AAAATGTAGGTATTTCCATGAGCGTTTTTCCTGTTGCAATGGCTGGCGGTAATATTGTTCTGGATATTACCAGCAAGGCCGATAGTTTGAGTTCTTCTAC
TCAGGCAAGTGATGTTATTACTAATCAAAGAAGTATTGCTACAACGGTTAATTTGCGTGATGGACAGACTCTTTTACTCGGTGGCCTCACTGATTATAAA
AACACTTCTCAGGATTCTGGCGTACCGTTCCTGTCTAAAATCCCTTTAATCGGCCTCCTGTTTAGCTCCCGCTCTGATTCTAACGAGGAAAGCACGTTAT
ACGTGCTCGTCAAAGCAACCATAGTACGCGCCCTGTAGCGGCGCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGCGTGACCGCTACACTTGCCAGCG
CCCTAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGCTCCCTTTAGGGTTCCG
ATTTAGTGCTTTACGGCACCTCGACCCCAAAAAACTTGATTTGGGTGATGGTTCACGTAGTGGGCCATCGCCCTGATAGACGGTTTTTCGCCCTTTGACG
TTGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAAACTGGAACAACACTCAACCCTATCTCGGGCTATTCTTTTGATTTATAAGGGATTTTGCCGA
TTTCGGAACCACCATCAAACAGGATTTTCGCCTGCTGGGGCAAACCAGCGTGGACCGCTTGCTGCAACTCTCTCAGGGCCAGGCGGTGAAGGGCAATCAG
CTGTTGCCCGTCTCACTGGTGAAAAGAAAAACCACCCTGGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCAC
GACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTTCCGG
CTCGTATGTTGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCTATGACCATGATTACGAATTCGAGCTCGGTACCCGGGGATCCTCAAC
TGTGAGGAGGCTCACGGACGCGAAGAACAGGCACGCGTGCTGGCAGAAACCCCCGGTATGACCGTGAAAACGGCCCGCCGCATTCTGGCCGCAGCACCAC
AGAGTGCACAGGCGCGCAGTGACACTGCGCTGGATCGTCTGATGCAGGGGGCACCGGCACCGCTGGCTGCAGGTAACCCGGCATCTGATGCCGTTAACGA
TTTGCTGAACACACCAGTGTAAGGGATGTTTATGACGAGCAAAGAAACCTTTACCCATTACCAGCCGCAGGGCAACAGTGACCCGGCTCATACCGCAACC
GCGCCCGGCGGATTGAGTGCGAAAGCGCCTGCAATGACCCCGCTGATGCTGGACACCTCCAGCCGTAAGCTGGTTGCGTGGGATGGCACCACCGACGGTG
CTGCCGTTGGCATTCTTGCGGTTGCTGCTGACCAGACCAGCACCACGCTGACGTTCTACAAGTCCGGCACGTTCCGTTATGAGGATGTGCTCTGGCCGGA
GGCTGCCAGCGACGAGACGAAAAAACGGACCGCGTTTGCCGGAACGGCAATCAGCATCGTTTAACTTTACCCTTCATCACTAAAGGCCGCCTGTGCGGCT
TTTTTTACGGGATTTTTTTATGTCGATGTACACAACCGCCCAACTGCTGGCGGCAAATGAGCAGAAATTTAAGTTTGATCCGCTGTTTCTGCGTCTCTTT
TTCCGTGAGAGCTATCCCTTCACCACGGAGAAAGTCTATCTCTCACAAATTCCGGGACTGGTAAACATGGCGCTGTACGTTTCGCCGATTGTTTCCGGTG
AGGTTATCCGTTCCCGTGGCGGCTCCACCTCTGAAAGCTTGGCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAA
TCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGG
CGCTTTGCCTGGTTTCCGGCACCAGAAGCGGTGCCGGAAAGCTGGCTGGAGTGCGATCTTCCTGAGGCCGATACTGTCGTCGTCCCCTCAAACTGGCAGA
TGCACGGTTACGATGCGCCCATCTACACCAACGTGACCTATCCCATTACGGTCAATCCGCCGTTTGTTCCCACGGAGAATCCGACGGGTTGTTACTCGCT
CACATTTAATGTTGATGAAAGCTGGCTACAGGAAGGCCAGACGCGAATTATTTTTGATGGCGTTCCTATTGGTTAAAAAATGAGCTGATTTAACAAAAAT
TTAATGCGAATTTTAACAAAATATTAACGTTTACAATTTAAATATTTGCTTATACAATCTTCCTGTTTTTGGGGCTTTTCTGATTATCAACCGGGGTACA
TATGATTGACATGCTAGTTTTACGATTACCGTTCATCGATTCTCTTGTTTGCTCCAGACTCTCA
""",
)
_8634 = re.sub(
r"\s",
"",
"""
GAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAAACTGGAACAACACTCAACCCTATCTCGGGCTATTCTTTTGATTTATAAGGGATTTTGCCGATTT
CGGAACCACCATCAAACAGGATTTTCGCCTGCTGGGGCAAACCAGCGTGGACCGCTTGCTGCAACTCTCTCAGGGCCAGGCGGTGAAGGGCAATCAGCTG
TTGCCCGTCTCACTGGTGAAAAGAAAAACCACCCTGGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCACGAC
AGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTC
GTATGTTGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCTATGACCATGATTACGAATTCGAGCTCGGTACCCGGGGATCCATTCTCCT
GTGACTCGGAAGTGCATTTATCATCTCCATAAAACAAAACCCGCCGTAGCGAGTTCAGATAAAATAAATCCCCGCGAGTGCGAGGATTGTTATGTAATAT
TGGGTTTAATCATCTATATGTTTTGTACAGAGAGGGCAAGTATCGTTTCCACCGTACTCGTGATAATAATTTTGCACGGTATCAGTCATTTCTCGCACAT
TGCAGAATGGGGATTTGTCTTCATTAGACTTATAAACCTTCATGGAATATTTGTATGCCGACTCTATATCTATACCTTCATCTACATAAACACCTTCGTG
ATGTCTGCATGGAGACAAGACACCGGATCTGCACAACATTGATAACGCCCAATCTTTTTGCTCAGACTCTAACTCATTGATACTCATTTATAAACTCCTT
GCAATGTATGTCGTTTCAGCTAAACGGTATCAGCAATGTTTATGTAAAGAAACAGTAAGATAATACTCAACCCGATGTTTGAGTACGGTCATCATCTGAC
ACTACAGACTCTGGCATCGCTGTGAAGACGACGCGAAATTCAGCATTTTCACAAGCGTTATCTTTTACAAAACCGATCTCACTCTCCTTTGATGCGAATG
CCAGCGTCAGACATCATATGCAGATACTCACCTGCATCCTGAACCCATTGACCTCCAACCCCGTAATAGCGATGCGTAATGATGTCGATAGTTACTAACG
GGTCTTGTTCGATTAACTGCCGCAGAAACTCTTCCAGGTCACCAGTGCAGTGCTTGATAACAGGAGTCTTCCCAGGATGGCGAACAACAAGAAACTGGTT
TCCGTCTTCACGGACTTCGTTGCTTTCCAGTTTAGCAATACGCTTACTCCCATCCGAGATAACACCTTCGTAATACTCACGCTGCTCGTTGAGTTTTGAT
TTTGCTGTTTCAAGCTCAACACGCAGTTTCCCTACTGTTAGCGCAATATCCTCGTTCTCCTGGTCGCGGCGTTTGATGTATTGCTGGTTTCTTTCCCGTT
CATCCAGCAGTTCCAGCACAATCGATGGTGTTACCAATTCATGGAAAAGGTCTGCGTCAAATCCCCAGTCGTCATGCATTGCCTGCTCTGCCGCTTCACG
CAGTGCCTGAGAGTTAATTTCGCTCACTTCGAACCTCTCTGTTTACTGATAAGTTCCAGATCCTCCTGGCAACTTGCACAAGTCCGACAACCCTGAACGA
CCAGGCGTCTTCGTTCATCTATCGGATCGCCACACTCACAACAATGAGTGGCAGATATAGCCTGGTGGTTCAGGCGGCGCATTTTTATTGCTGTGTTGCG
CTGTAATTCTTCTATTTCTGATGCTGAATCAATGATGTCTGCCATCTTTCATTAATCCCTGAACTGTTGGTTAATACGCATGAGGGTGAATGCGAATAAT
AAAGCTTGGCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTG
GCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGGCGCTTTGCCTGGTTTCCGGCACCAGAAGCGGTG
CCGGAAAGCTGGCTGGAGTGCGATCTTCCTGAGGCCGATACTGTCGTCGTCCCCTCAAACTGGCAGATGCACGGTTACGATGCGCCCATCTACACCAACG
TGACCTATCCCATTACGGTCAATCCGCCGTTTGTTCCCACGGAGAATCCGACGGGTTGTTACTCGCTCACATTTAATGTTGATGAAAGCTGGCTACAGGA
AGGCCAGACGCGAATTATTTTTGATGGCGTTCCTATTGGTTAAAAAATGAGCTGATTTAACAAAAATTTAATGCGAATTTTAACAAAATATTAACGTTTA
CAATTTAAATATTTGCTTATACAATCTTCCTGTTTTTGGGGCTTTTCTGATTATCAACCGGGGTACATATGATTGACATGCTAGTTTTACGATTACCGTT
CATCGATTCTCTTGTTTGCTCCAGACTCTCAGGCAATGACCTGATAGCCTTTGTAGATCTCTCAAAAATAGCTACCCTCTCCGGCATTAATTTATCAGCT
AGAACGGTTGAATATCATATTGATGGTGATTTGACTGTCTCCGGCCTTTCTCACCCTTTTGAATCTTTACCTACACATTACTCAGGCATTGCATTTAAAA
TATATGAGGGTTCTAAAAATTTTTATCCTTGCGTTGAAATAAAGGCTTCTCCCGCAAAAGTATTACAGGGTCATAATGTTTTTGGTACAACCGATTTAGC
TTTATGCTCTGAGGCTTTATTGCTTAATTTTGCTAATTCTTTGCCTTGCCTGTATGATTTATTGGATGTTAATGCTACTACTATTAGTAGAATTGATGCC
ACCTTTTCAGCTCGCGCCCCAAATGAAAATATAGCTAAACAGGTTATTGACCATTTGCGAAATGTATCTAATGGTCAAACTAAATCTACTCGTTCGCAGA
ATTGGGAATCAACTGTTATATGGAATGAAACTTCCAGACACCGTACTTTAGTTGCATATTTAAAACATGTTGAGCTACAGCATTATATTCAGCAATTAAG
CTCTAAGCCATCCGCAAAAATGACCTCTTATCAAAAGGAGCAATTAAAGGTACTCTCTAATCCTGACCTGTTGGAGTTTGCTTCCGGTCTGGTTCGCTTT
GAAGCTCGAATTAAAACGCGATATTTGAAGTCTTTCGGGCTTCCTCTTAATCTTTTTGATGCAATCCGCTTTGCTTCTGACTATAATAGTCAGGGTAAAG
ACCTGATTTTTGATTTATGGTCATTCTCGTTTTCTGAACTGTTTAAAGCATTTGAGGGGGATTCAATGAATATTTATGACGATTCCGCAGTATTGGACGC
TATCCAGTCTAAACATTTTACTATTACCCCCTCTGGCAAAACTTCTTTTGCAAAAGCCTCTCGCTATTTTGGTTTTTATCGTCGTCTGGTAAACGAGGGT
TATGATAGTGTTGCTCTTACTATGCCTCGTAATTCCTTTTGGCGTTATGTATCTGCATTAGTTGAATGTGGTATTCCTAAATCTCAACTGATGAATCTTT
CTACCTGTAATAATGTTGTTCCGTTAGTTCGTTTTATTAACGTAGATTTTTCTTCCCAACGTCCTGACTGGTATAATGAGCCAGTTCTTAAAATCGCATA
AGGTAATTCACAATGATTAAAGTTGAAATTAAACCATCTCAAGCCCAATTTACTACTCGTTCTGGTGTTTCTCGTCAGGGCAAGCCTTATTCACTGAATG
AGCAGCTTTGTTACGTTGATTTGGGTAATGAATATCCGGTTCTTGTCAAGATTACTCTTGATGAAGGTCAGCCAGCCTATGCGCCTGGTCTGTACACCGT
TCATCTGTCCTCTTTCAAAGTTGGTCAGTTCGGTTCCCTTATGATTGACCGTCTGCGCCTCGTTCCGGCTAAGTAACATGGAGCAGGTCGCGGATTTCGA
CACAATTTATCAGGCGATGATACAAATCTCCGTTGTACTTTGTTTCGCGCTTGGTATAATCGCTGGGGGTCAAAGATGAGTGTTTTAGTGTATTCTTTTG
CCTCTTTCGTTTTAGGTTGGTGCCTTCGTAGTGGCATTACGTATTTTACCCGTTTAATGGAAACTTCCTCATGAAAAAGTCTTTAGTCCTCAAAGCCTCT
GTAGCCGTTGCTACCCTCGTTCCGATGCTGTCTTTCGCTGCTGAGGGTGACGATCCCGCAAAAGCGGCCTTTAACTCCCTGCAAGCCTCAGCGACCGAAT
ATATCGGTTATGCGTGGGCGATGGTTGTTGTCATTGTCGGCGCAACTATCGGTATCAAGCTGTTTAAGAAATTCACCTCGAAAGCAAGCTGATAAACCGA
TACAATTAAAGGCTCCTTTTGGAGCCTTTTTTTTGGAGATTTTCAACGTGAAAAAATTATTATTCGCAATTCCTTTAGTTGTTCCTTTCTATTCTCACTC
CGCTGAAACTGTTGAAAGTTGTTTAGCAAAATCCCATACAGAAAATTCATTTACTAACGTCTGGAAAGACGACAAAACTTTAGATCGTTACGCTAACTAT
GAGGGCTGTCTGTGGAATGCTACAGGCGTTGTAGTTTGTACTGGTGACGAAACTCAGTGTTACGGTACATGGGTTCCTATTGGGCTTGCTATCCCTGAAA
ATGAGGGTGGTGGCTCTGAGGGTGGCGGTTCTGAGGGTGGCGGTTCTGAGGGTGGCGGTACTAAACCTCCTGAGTACGGTGATACACCTATTCCGGGCTA
TACTTATATCAACCCTCTCGACGGCACTTATCCGCCTGGTACTGAGCAAAACCCCGCTAATCCTAATCCTTCTCTTGAGGAGTCTCAGCCTCTTAATACT
TTCATGTTTCAGAATAATAGGTTCCGAAATAGGCAGGGGGCATTAACTGTTTATACGGGCACTGTTACTCAAGGCACTGACCCCGTTAAAACTTATTACC
AGTACACTCCTGTATCATCAAAAGCCATGTATGACGCTTACTGGAACGGTAAATTCAGAGACTGCGCTTTCCATTCTGGCTTTAATGAGGATTTATTTGT
TTGTGAATATCAAGGCCAATCGTCTGACCTGCCTCAACCTCCTGTCAATGCTGGCGGCGGCTCTGGTGGTGGTTCTGGTGGCGGCTCTGAGGGTGGTGGC
TCTGAGGGTGGCGGTTCTGAGGGTGGCGGCTCTGAGGGAGGCGGTTCCGGTGGTGGCTCTGGTTCCGGTGATTTTGATTATGAAAAGATGGCAAACGCTA
ATAAGGGGGCTATGACCGAAAATGCCGATGAAAACGCGCTACAGTCTGACGCTAAAGGCAAACTTGATTCTGTCGCTACTGATTACGGTGCTGCTATCGA
TGGTTTCATTGGTGACGTTTCCGGCCTTGCTAATGGTAATGGTGCTACTGGTGATTTTGCTGGCTCTAATTCCCAAATGGCTCAAGTCGGTGACGGTGAT
AATTCACCTTTAATGAATAATTTCCGTCAATATTTACCTTCCCTCCCTCAATCGGTTGAATGTCGCCCTTTTGTCTTTGGCGCTGGTAAACCATATGAAT
TTTCTATTGATTGTGACAAAATAAACTTATTCCGTGGTGTCTTTGCGTTTCTTTTATATGTTGCCACCTTTATGTATGTATTTTCTACGTTTGCTAACAT
ACTGCGTAATAAGGAGTCTTAATCATGCCAGTTCTTTTGGGTATTCCGTTATTATTGCGTTTCCTCGGTTTCCTTCTGGTAACTTTGTTCGGCTATCTGC
TTACTTTTCTTAAAAAGGGCTTCGGTAAGATAGCTATTGCTATTTCATTGTTTCTTGCTCTTATTATTGGGCTTAACTCAATTCTTGTGGGTTATCTCTC
TGATATTAGCGCTCAATTACCCTCTGACTTTGTTCAGGGTGTTCAGTTAATTCTCCCGTCTAATGCGCTTCCCTGTTTTTATGTTATTCTCTCTGTAAAG
GCTGCTATTTTCATTTTTGACGTTAAACAAAAAATCGTTTCTTATTTGGATTGGGATAAATAATATGGCTGTTTATTTTGTAACTGGCAAATTAGGCTCT
GGAAAGACGCTCGTTAGCGTTGGTAAGATTCAGGATAAAATTGTAGCTGGGTGCAAAATAGCAACTAATCTTGATTTAAGGCTTCAAAACCTCCCGCAAG
TCGGGAGGTTCGCTAAAACGCCTCGCGTTCTTAGAATACCGGATAAGCCTTCTATATCTGATTTGCTTGCTATTGGGCGCGGTAATGATTCCTACGATGA
AAATAAAAACGGCTTGCTTGTTCTCGATGAGTGCGGTACTTGGTTTAATACCCGTTCTTGGAATGATAAGGAAAGACAGCCGATTATTGATTGGTTTCTA
CATGCTCGTAAATTAGGATGGGATATTATTTTTCTTGTTCAGGACTTATCTATTGTTGATAAACAGGCGCGTTCTGCATTAGCTGAACATGTTGTTTATT
GTCGTCGTCTGGACAGAATTACTTTACCTTTTGTCGGTACTTTATATTCTCTTATTACTGGCTCGAAAATGCCTCTGCCTAAATTACATGTTGGCGTTGT
TAAATATGGCGATTCTCAATTAAGCCCTACTGTTGAGCGTTGGCTTTATACTGGTAAGAATTTGTATAACGCATATGATACTAAACAGGCTTTTTCTAGT
AATTATGATTCCGGTGTTTATTCTTATTTAACGCCTTATTTATCACACGGTCGGTATTTCAAACCATTAAATTTAGGTCAGAAGATGAAATTAACTAAAA
TATATTTGAAAAAGTTTTCTCGCGTTCTTTGTCTTGCGATTGGATTTGCATCAGCATTTACATATAGTTATATAACCCAACCTAAGCCGGAGGTTAAAAA
GGTAGTCTCTCAGACCTATGATTTTGATAAATTCACTATTGACTCTTCTCAGCGTCTTAATCTAAGCTATCGCTATGTTTTCAAGGATTCTAAGGGAAAA
TTAATTAATAGCGACGATTTACAGAAGCAAGGTTATTCACTCACATATATTGATTTATGTACTGTTTCCATTAAAAAAGGTAATTCAAATGAAATTGTTA
AATGTAATTAATTTTGTTTTCTTGATGTTTGTTTCATCATCTTCTTTTGCTCAGGTAATTGAAATGAATAATTCGCCTCTGCGCGATTTTGTAACTTGGT
ATTCAAAGCAATCAGGCGAATCCGTTATTGTTTCTCCCGATGTAAAAGGTACTGTTACTGTATATTCATCTGACGTTAAACCTGAAAATCTACGCAATTT
CTTTATTTCTGTTTTACGTGCAAATAATTTTGATATGGTAGGTTCTAACCCTTCCATTATTCAGAAGTATAATCCAAACAATCAGGATTATATTGATGAA
TTGCCATCATCTGATAATCAGGAATATGATGATAATTCCGCTCCTTCTGGTGGTTTCTTTGTTCCGCAAAATGATAATGTTACTCAAACTTTTAAAATTA
ATAACGTTCGGGCAAAGGATTTAATACGAGTTGTCGAATTGTTTGTAAAGTCTAATACTTCTAAATCCTCAAATGTATTATCTATTGACGGCTCTAATCT
ATTAGTTGTTAGTGCTCCTAAAGATATTTTAGATAACCTTCCTCAATTCCTTTCAACTGTTGATTTGCCAACTGACCAGATATTGATTGAGGGTTTGATA
TTTGAGGTTCAGCAAGGTGATGCTTTAGATTTTTCATTTGCTGCTGGCTCTCAGCGTGGCACTGTTGCAGGCGGTGTTAATACTGACCGCCTCACCTCTG
TTTTATCTTCTGCTGGTGGTTCGTTCGGTATTTTTAATGGCGATGTTTTAGGGCTATCAGTTCGCGCATTAAAGACTAATAGCCATTCAAAAATATTGTC
TGTGCCACGTATTCTTACGCTTTCAGGTCAGAAGGGTTCTATCTCTGTTGGCCAGAATGTCCCTTTTATTACTGGTCGTGTGACTGGTGAATCTGCCAAT
GTAAATAATCCATTTCAGACGATTGAGCGTCAAAATGTAGGTATTTCCATGAGCGTTTTTCCTGTTGCAATGGCTGGCGGTAATATTGTTCTGGATATTA
CCAGCAAGGCCGATAGTTTGAGTTCTTCTACTCAGGCAAGTGATGTTATTACTAATCAAAGAAGTATTGCTACAACGGTTAATTTGCGTGATGGACAGAC
TCTTTTACTCGGTGGCCTCACTGATTATAAAAACACTTCTCAGGATTCTGGCGTACCGTTCCTGTCTAAAATCCCTTTAATCGGCCTCCTGTTTAGCTCC
CGCTCTGATTCTAACGAGGAAAGCACGTTATACGTGCTCGTCAAAGCAACCATAGTACGCGCCCTGTAGCGGCGCATTAAGCGCGGCGGGTGTGGTGGTT
ACGCGCAGCGTGACCGCTACACTTGCCAGCGCCCTAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCCCGTCAAG
CTCTAAATCGGGGGCTCCCTTTAGGGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCAAAAAACTTGATTTGGGTGATGGTTCACGTAGTGGGCCATC
GCCCTGATAGACGGTTTTTCGCCCTTTGACGTTG
""",
)
_m13_variants = {
M13Variant.p7249: _7249,
M13Variant.p7560: _7560,
M13Variant.p8064: _8064,
M13Variant.p8634: _8634,
}
##################
# keys
# Design keys
version_key = "version"
grid_key = "grid"
helices_key = "helices"
strands_key = "strands"
scaffold_key = "scaffold"
helices_view_order_key = "helices_view_order"
is_origami_key = "is_origami"
design_modifications_key = "modifications_in_design" # legacy key for when we stored all mods in one dict
design_modifications_5p_key = "modifications_5p_in_design"
design_modifications_3p_key = "modifications_3p_in_design"
design_modifications_int_key = "modifications_int_in_design"
geometry_key = "geometry"
groups_key = "groups"
# Geometry keys
rise_per_base_pair_key = "rise_per_base_pair"
legacy_rise_per_base_pair_keys = ["z_step"]
helix_radius_key = "helix_radius"
bases_per_turn_key = "bases_per_turn"
minor_groove_angle_key = "minor_groove_angle"
inter_helix_gap_key = "inter_helix_gap"
# Helix keys
idx_on_helix_key = "idx"
max_offset_key = "max_offset"
min_offset_key = "min_offset"
grid_position_key = "grid_position"
position_key = "position"
legacy_position_keys = ["origin"]
major_tick_distance_key = "major_tick_distance"
major_ticks_key = "major_ticks"
major_tick_start_key = "major_tick_start"
major_tick_periodic_distances_key = "major_tick_periodic_distances"
group_key = "group"
# Position keys
position_x_key = "x"
position_y_key = "y"
position_z_key = "z"
pitch_key = "pitch"
roll_key = "roll"
yaw_key = "yaw"
position_origin_key = "origin"
# Strand keys
strand_name_key = "name"
circular_key = "circular"
color_key = "color"
dna_sequence_key = "sequence"
legacy_dna_sequence_keys = ["dna_sequence"] # support legacy names for these ideas
domains_key = "domains"
legacy_domains_keys = ["substrands"] # support legacy names for these ideas
vendor_key = "vendor"
legacy_vendor_keys = ["idt"]
is_scaffold_key = "is_scaffold"
modification_5p_key = "5prime_modification"
modification_3p_key = "3prime_modification"
modifications_int_key = "internal_modifications"
strand_label_key = "label"
# Domain keys
domain_name_key = "name"
helix_idx_key = "helix"
forward_key = "forward"
legacy_forward_keys = ["right"] # support legacy names for these ideas
start_key = "start"
end_key = "end"
deletions_key = "deletions"
insertions_key = "insertions"
domain_label_key = "label"
# Loopout keys
loopout_key = "loopout"
# Extension keys
extension_key = "extension_num_bases"
display_length_key = "display_length"
display_angle_key = "display_angle"
# Modification keys
mod_location_key = "location"
mod_display_text_key = "display_text"
mod_id_key = "id"
mod_vendor_code_key = "vendor_code"
legacy_mod_vendor_code_keys = ["idt_text"]
mod_font_size_key = "font_size"
mod_allowed_bases_key = "allowed_bases"
mod_connector_length_key = "connector_length"
# vendor keys
vendor_scale_key = "scale"
vendor_purification_key = "purification"
vendor_plate_key = "plate"
vendor_well_key = "well"
# legacy; not written anymore as part of vendor fields, but may be read from older versions of the JSON if
# the Strand has no name but the VendorField does have a name
vendor_name_key = "name"
# end keys
##################
# end constants
##########################################################################
##########################################################################
# modification classes
default_connector_length = 4
[docs]
class ModificationType(enum.Enum):
"""
Type of modification (5', 3', or internal).
"""
five_prime = "5'"
"""5' modification type"""
three_prime = "3'"
"""3' modification type"""
internal = "internal"
"""internal modification type"""
def key(self) -> str:
if self == ModificationType.five_prime:
return design_modifications_5p_key
elif self == ModificationType.three_prime:
return design_modifications_3p_key
elif self == ModificationType.internal:
return design_modifications_int_key
else:
raise AssertionError(f"unknown ModificationType {self}")
[docs]
@dataclass(frozen=True, eq=True)
class Modification(_JSONSerializable, ABC):
"""
Abstract case class of modifications (to DNA sequences, e.g., biotin or Cy3).
Use concrete subclasses
:any:`Modification3Prime`, :any:`Modification5Prime`, or :any:`ModificationInternal`
to instantiate.
:data:`Modification.vendor_code` is used as a unique ID.
Each :data:`Modification.vendor_code` must be unique.
This can cause problems with some vendors such as Eurofins
(https://eurofinsgenomics.com/en/products/dnarna-synthesis/mods/) that reuse the same vendor code
such as [BIOTEG].
See issue https://github.com/UC-Davis-molecular-computing/scadnano-python-package/issues/283.
For example if you create a 5' modification
to represent 6 T bases: ``t6_5p = Modification5Prime(display_text='6T', vendor_code='TTTTTT')``
(this was a useful hack for putting single-stranded extensions on strands before the :any:`Extension`
class was created to directly support this idea),
then this would clash with a similar 3' modification without specifying unique IDs for them:
``t6_3p = Modification3Prime(display_text='6T', vendor_code='TTTTTT') # ERROR``.
In general it is recommended to create a single :any:`Modification` object for each *type* of
modification in the design. For example, if many strands have a 5' biotin, then it is recommended to
create a single :any:`Modification` object and re-use it on each strand with a 5' biotin:
.. code-block:: python
biotin_5p = Modification5Prime(display_text='B', vendor_code='/5Biosg/')
design.draw_strand(0, 0).move(8).with_modification_5p(biotin_5p)
design.draw_strand(1, 0).move(8).with_modification_5p(biotin_5p)
"""
display_text: str
"""
Short text to display in the web interface as an "icon"
visually representing the modification, e.g., ``'B'`` for biotin or ``'Cy3'`` for Cy3.
This can be arbitrary Unicode; for example, to represent a fluorophore,
one can use the "glowing star" symbol \U0001f31f,
or to represent a quencher, one can use the "large black circle" symbol \u2b24.
"""
vendor_code: str
"""
Text string specifying this modification used by a vendor (a DNA synthesis company such as IDT).
For example, for IDT DNA (https://www.idtdna.com/), use '/5Biosg/' for 5' biotin.
This field must be unique to the :any:`Modification`; undefined behavior could result if two different
:any:`Modification` objects have the same :data:`Modification.vendor_code`.
"""
connector_length: int = default_connector_length
"""
Length of "connector" displayed in web interface.
Drawn like a carbon chain to offset the display of the modification vertically from the DNA strand.
This field is useful for putting two nearby modifications at different heights so that their
text does not overlap.
Set the length to 0 to not draw a connector.
"""
def to_json_serializable(self, suppress_indent: bool = True, **kwargs: Any) -> dict[str, Any]:
ret: dict[str, Any] = {
mod_display_text_key: self.display_text,
mod_vendor_code_key: self.vendor_code,
}
if self.connector_length != default_connector_length:
ret[mod_connector_length_key] = self.connector_length
return ret
@staticmethod
def from_json(json_map: dict[str, Any]) -> Modification:
location = json_map[mod_location_key]
if location == "5'":
return Modification5Prime.from_json(json_map)
elif location == "3'":
return Modification3Prime.from_json(json_map)
elif location == "internal":
return ModificationInternal.from_json(json_map)
else:
raise IllegalDesignError(f'unknown Modification location "{location}"')
@staticmethod
@abstractmethod
def modification_type() -> ModificationType:
pass
[docs]
@dataclass(frozen=True, eq=True)
class Modification5Prime(Modification):
"""
5' modification of DNA sequence, e.g., biotin or Cy3.
In general it is recommended to create a single :any:`Modification` object for each *type* of
modification in the design. For example, if many strands have a 5' biotin, then it is recommended to
create a single :any:`Modification` object and re-use it on each strand with a 5' biotin:
.. code-block:: python
biotin_5p = Modification5Prime(display_text='B', vendor_code='/5Biosg/')
design.draw_strand(0, 0).move(8).with_modification_5p(biotin_5p)
design.draw_strand(1, 0).move(8).with_modification_5p(biotin_5p)
"""
def to_json_serializable(self, suppress_indent: bool = True, **kwargs: Any) -> dict[str, Any]:
ret = super().to_json_serializable(suppress_indent)
ret[mod_location_key] = "5'"
return ret
@staticmethod
def from_json(json_map: dict[str, Any]) -> Modification5Prime:
display_text = json_map[mod_display_text_key]
location = json_map[mod_location_key]
assert location == "5'"
vendor_code = mandatory_field(
Modification5Prime, json_map, mod_vendor_code_key, legacy_keys=legacy_mod_vendor_code_keys
)
connector_length = json_map.get(mod_connector_length_key, default_connector_length)
return Modification5Prime(display_text=display_text, vendor_code=vendor_code, connector_length=connector_length)
@staticmethod
def modification_type() -> ModificationType:
return ModificationType.five_prime
[docs]
@dataclass(frozen=True, eq=True)
class Modification3Prime(Modification):
"""
3' modification of DNA sequence, e.g., biotin or Cy3.
In general it is recommended to create a single :any:`Modification` object for each *type* of
modification in the design. For example, if many strands have a 3' biotin, then it is recommended to
create a single :any:`Modification` object and re-use it on each strand with a 3' biotin:
.. code-block:: python
biotin_3p = Modification3Prime(display_text='B', vendor_code='/3Bio/')
design.draw_strand(0, 0).move(8).with_modification_3p(biotin_3p)
design.draw_strand(1, 0).move(8).with_modification_3p(biotin_3p)
"""
def to_json_serializable(self, suppress_indent: bool = True, **kwargs: Any) -> dict[str, Any]:
ret = super().to_json_serializable(suppress_indent)
ret[mod_location_key] = "3'"
return ret
@staticmethod
def from_json(json_map: dict[str, Any]) -> Modification3Prime:
display_text = json_map[mod_display_text_key]
location = json_map[mod_location_key]
assert location == "3'"
vendor_code = mandatory_field(
Modification3Prime, json_map, mod_vendor_code_key, legacy_keys=legacy_mod_vendor_code_keys
)
connector_length = json_map.get(mod_connector_length_key, default_connector_length)
return Modification3Prime(display_text=display_text, vendor_code=vendor_code, connector_length=connector_length)
@staticmethod
def modification_type() -> ModificationType:
return ModificationType.three_prime
[docs]
@dataclass(frozen=True, eq=True)
class ModificationInternal(Modification):
"""Internal modification of DNA sequence, e.g., biotin or Cy3."""
allowed_bases: AbstractSet[str] | None = None
"""
If None, then this is an internal modification that goes between bases.
In this case, the key :data:`Strand.modifications_int` specifying the position of the internal
modification is interpreted to mean that the modification goes *after* the base at that position.
(For example, this is the parameter `idx` in :meth:`StrandBuilder.with_modification_internal`.)
If instead it is a list of bases, then this is an internal modification that attaches to a base,
and this lists the allowed bases for this internal modification to be placed at.
For example, internal biotins for IDT must be at a T. If any base is allowed, it should be
``{'A','C','G','T'}``.
"""
def __post_init__(self) -> None:
if self.allowed_bases is not None and not isinstance(self.allowed_bases, frozenset):
object.__setattr__(self, "allowed_bases", frozenset(self.allowed_bases))
def to_json_serializable(self, suppress_indent: bool = True, **kwargs: Any) -> dict[str, Any]:
ret = super().to_json_serializable(suppress_indent)
ret[mod_location_key] = "internal"
if self.allowed_bases is not None:
ret[mod_allowed_bases_key] = (
NoIndent(list(self.allowed_bases)) if suppress_indent else list(self.allowed_bases)
)
return ret
@staticmethod
def from_json(json_map: dict[str, Any]) -> ModificationInternal:
display_text = json_map[mod_display_text_key]
location = json_map[mod_location_key]
assert location == "internal"
vendor_code = mandatory_field(
Modification5Prime, json_map, mod_vendor_code_key, legacy_keys=legacy_mod_vendor_code_keys
)
allowed_bases_list = json_map.get(mod_allowed_bases_key)
allowed_bases = frozenset(allowed_bases_list) if allowed_bases_list is not None else None
connector_length = json_map.get(mod_connector_length_key, default_connector_length)
return ModificationInternal(
display_text=display_text,
vendor_code=vendor_code,
allowed_bases=allowed_bases,
connector_length=connector_length,
)
@staticmethod
def modification_type() -> ModificationType:
return ModificationType.internal
# end modification classes
##########################################################################
[docs]
@dataclass(frozen=True)
class Position3D(_JSONSerializable):
"""
Position (x,y,z) in 3D space.
"""
x: float = 0
"""x-coordinate of position.
Increasing `x` moves right in the side view and out of the screen in the main view."""
y: float = 0
"""y-coordinate of position.
Increasing `y` moves down in the side and main views, i.e., "screen coordinates".
(though this can be rotated to Cartesian coordinates, where y goes up,
by selecting "invert y/z axes" in the View menu of scadnano.)"""
z: float = 0
"""z-coordinate of position.
Increasing `z` moves right in the main view and into the screen in the side view."""
def to_json_serializable(self, suppress_indent: bool = True, **kwargs: Any) -> dict[str, Any]:
dct: dict[str, Any] = dict(self.__dict__)
# return NoIndent(dct) if suppress_indent else dct
return dct
@staticmethod
def from_json(json_map: dict[str, Any]) -> Position3D:
if position_origin_key in json_map:
origin_ = json_map[position_origin_key]
x = origin_[position_x_key]
y = origin_[position_y_key]
z = origin_[position_z_key]
else:
x = json_map[position_x_key]
y = json_map[position_y_key]
z = json_map[position_z_key]
return Position3D(x=x, y=y, z=z)
def __add__(self, other: Position3D) -> Position3D:
"""
:param other:
other position to add to this one
:return:
sum of the two positions
"""
return Position3D(self.x + other.x, self.y + other.y, self.z + other.z)
origin: Position3D = Position3D(x=0, y=0, z=0)
[docs]
@dataclass
class HelixGroup(_JSONSerializable):
"""
Represents a set of properties to apply to a specific group of :any:`Helix`'s in the :any:`Design`.
A :any:`HelixGroup` is useful for grouping together helices that should all be in parallel,
as part of a design where different groups are not parallel. In particular, each :any:`HelixGroup`
can be given its own 3D position and pitch/yaw/roll orientation angles. Each :any:`HelixGroup` does
not actually *contain* its helices; they are associated through the field :data:`Helix.group`, which is
a string representing a key in the dict ``groups`` specified in the constructor for :any:`Design`.
If there are :any:`HelixGroup`'s explicitly specified, then the field :py:data:`Design.grid` is ignored.
Each :any:`HelixGroup` has its own grid, and the fields :py:data:`Helix.position` or
:py:data:`Helix.grid_position` are considered relative to the origin of that :any:`HelixGroup`
(i.e., the value :py:data:`HelixGroup.position`). Although an individual :any:`Helix`
can have a non-zero :py:data:`Helix.roll` (which is in addition to whatever value there is for
:data:`HelixGroup.roll`), all helices in a group are parallel.
The three angles are interpreted to be applied in the following order: first yaw, then pitch, then roll,
using the "intrinsic rotation" convention
(see https://en.wikipedia.org/wiki/Euler_angles#Conventions_by_intrinsic_rotations).
This convention is not apparent in the scadnano web interface, which only directly shows pitch,
but it shows up, for example, in oxDNA export via :meth:`Design.to_oxdna_format`.
See the fields :data:`HelixGroup.pitch`, :data:`HelixGroup.roll`, and :data:`HelixGroup.yaw`
for an explanation how to interpret each rotation.
"""
position: Position3D = origin
"""The "origin" of this :any:`HelixGroup`."""
pitch: float = 0
"""Angle in the main view plane; 0 means pointing to the right (min_offset on left, max_offset on right).
Rotation is *clockwise* in the main view, i.e., clockwise in the Y-Z plane, around the X-axis,
when Y-axis points down, Z-axis points right, and X-axis points out of the page.
See https://en.wikipedia.org/wiki/Aircraft_principal_axes.
Units are degrees."""
roll: float = 0
"""Same meaning as :py:data:`Helix.roll`, applied to every :any:`Helix` in the group,
i.e., it represents the rotation about the axis of a helix.
Rotation is *clockwise* in the side view, i.e., in the X-Y plane, around the Z-axis,
when X-axis points right, Y-axis points down, and Z-axis points into the page."""
yaw: float = 0
"""Third angle for orientation besides :py:data:`HelixGroup.pitch` and :py:data:`HelixGroup.roll`.
Not visually displayed in scadnano, but here to support more general 3D applications.
Rotation is *clockwise* while looking down onto the main view,
i.e., in the X-Z plane, around the Y-axis,
when X-axis points down, Z-axis points right, and Y-axis points into the page.
See https://en.wikipedia.org/wiki/Aircraft_principal_axes.
Units are degrees."""
helices_view_order: list[int] | None = None
"""Order in which to display the :any:`Helix`'s in the group in the 2D view; if None, then the order
is given by the order of the fields :data:`Helix.idx` for each :any:`Helix` in this :any:`HelixGroup`."""
grid: Grid = Grid.none
""":any:`Grid` of this :any:`HelixGroup` used to interpret the field :data:`Helix.grid_position`."""
geometry: Geometry | None = None
"""
Optional custom :any:`Geometry` to specify for this :any:`HelixGroup`. If specified then
it is assumed to override the field :data:`Design.geometry`. This will affect, for instance,
where nucleotides and phosphate groups are placed when exporting to oxDNA or oxView via
:meth:`Design.to_oxview_format` or :meth:`Design.to_oxdna_format`.
"""
def has_default_position_and_orientation(self):
# we don't bother checking grid or helices_view_order because those are written to top-level
# fields of Design if the group is otherwise default
return self.position == origin and self.pitch == self.roll == self.yaw == 0
def to_json_serializable(self, suppress_indent: bool = True, **kwargs: Any) -> dict[str, Any]:
dct: dict[str, Any] = dict()
helix_idxs: list[int] = kwargs["helix_idxs"]
pos = self.position.to_json_serializable(suppress_indent)
dct[position_key] = NoIndent(pos) if suppress_indent else pos
if not _is_close(self.pitch, default_pitch):
dct[pitch_key] = self.pitch
if not _is_close(self.roll, default_roll):
dct[roll_key] = self.roll
if not _is_close(self.yaw, default_yaw):
dct[yaw_key] = self.yaw
dct[grid_key] = str(self.grid)[5:] # remove prefix 'Grid.'
default_helices_view_order = sorted(helix_idxs)
if self.helices_view_order != default_helices_view_order:
dct[helices_view_order_key] = NoIndent(self.helices_view_order)
if self.geometry is not None:
dct[geometry_key] = self.geometry.to_json_serializable(suppress_indent)
return dct
def _assign_default_helices_view_order(self, helices_in_group: dict[int, "Helix"]) -> None:
if self.helices_view_order is not None:
raise AssertionError(
"should not call _assign_default_helices_view_order if "
"HelixGroup.helices_view_order is not None, but it is "
f"{self.helices_view_order}"
)
helix_idxs = list(helices_in_group.keys())
self.helices_view_order = _check_helices_view_order_and_return(self.helices_view_order, helix_idxs)
@staticmethod
def from_json(json_map: dict, **kwargs: Any) -> HelixGroup:
grid: Grid = optional_field(Grid.none, json_map, grid_key, transformer=Grid)
# grid: Grid = Grid.none
# if grid_key in json_map:
# grid = Grid(json_map[grid_key])
num_helices: int = kwargs["num_helices"]
helices_view_order = json_map.get(helices_view_order_key)
if helices_view_order is not None:
if len(helices_view_order) != num_helices:
raise IllegalDesignError(
f"length of helices ({num_helices}) does not match "
f"length of helices_view_order ({len(helices_view_order)})"
)
position_map = mandatory_field(HelixGroup, json_map, position_key, legacy_keys=legacy_position_keys)
position = Position3D.from_json(position_map)
pitch = json_map.get(pitch_key, default_pitch)
roll = json_map.get(roll_key, default_roll)
yaw = json_map.get(yaw_key, default_yaw)
geometry = None
if geometry_key in json_map:
geometry = Geometry.from_json(json_map[geometry_key])
return HelixGroup(
position=position,
pitch=pitch,
yaw=yaw,
roll=roll,
helices_view_order=helices_view_order,
grid=grid,
geometry=geometry,
)
[docs]
def helices_view_order_inverse(self, idx: int) -> int:
"""
Given a :py:data:`Helix.idx` in this :any:`HelixGroup`, return its view order.
:param idx: index of :any:`Helix` in this :any:`HelixGroup`
:return: view order of the :any:`Helix`
:raises ValueError: if `idx` is not the index of a :any:`Helix` in this :any:`HelixGroup`
"""
if self.helices_view_order is None:
raise ValueError("cannot access helices_view_order_inverse until helices_view_order is set")
return self.helices_view_order.index(idx)
[docs]
@dataclass
class Geometry(_JSONSerializable):
"""Parameters controlling some geometric visualization/physical aspects of a :any:`Design`."""
rise_per_base_pair: float = 0.332
"""Distance in nanometers between two adjacent base pairs along the length of a DNA double helix."""
helix_radius: float = 1.0
"""Radius of a DNA helix in nanometers."""
bases_per_turn: float = 10.5
"""Number of DNA base pairs in a full turn of DNA."""
minor_groove_angle: float = 150.0
"""Minor groove angle in degrees."""
inter_helix_gap: float = 1.0
"""
Gap between helices in nanometers due to electrostatic repulsion. This is used by the scadnano
web interface to display an appropriate aspect ratio for 2D DNA structures.
The default value of 1.0 nm is approximately the average distance, as measured by atomic force
microscopy (AFM) images, for 2D DNA origami using the :data:`Grid.square` grid,
with 32 base pairs in between consecutive crossovers between two helices. Such a structure with `n`
parallel helices generally is measured to be about `3n` nm high on AFM images. Since each DNA helix
is 2 nm diameter, this implies an average inter-helix gap of 1.0 nm, though of course it is just an
average, and the actual gap varies depending on distance to the nearest crossover: at a crossover
the distance is close to 0 and halfway between two crossovers, the distance is greater than 1 nm.
This value may be inappropriate for designs with different crossover spacing, for example
single-stranded tiles with 21 base pairs between consecutive crossovers. (In that case 0.5 nm seems
to be a more appropriate approximation.)
"""
def distance_between_helices(self) -> float:
return 2 * self.helix_radius + self.inter_helix_gap
def is_default(self) -> bool:
return self == _default_geometry
@staticmethod
def from_json(json_map: dict) -> Geometry:
geometry = Geometry()
geometry.rise_per_base_pair = optional_field(
_default_geometry.rise_per_base_pair,
json_map,
rise_per_base_pair_key,
legacy_keys=legacy_rise_per_base_pair_keys,
)
geometry.helix_radius = optional_field(_default_geometry.helix_radius, json_map, helix_radius_key)
geometry.bases_per_turn = optional_field(_default_geometry.bases_per_turn, json_map, bases_per_turn_key)
geometry.minor_groove_angle = optional_field(
_default_geometry.minor_groove_angle, json_map, minor_groove_angle_key
)
geometry.inter_helix_gap = optional_field(_default_geometry.inter_helix_gap, json_map, inter_helix_gap_key)
return geometry
@staticmethod
def keys() -> list[str]:
return [
rise_per_base_pair_key,
helix_radius_key,
bases_per_turn_key,
minor_groove_angle_key,
inter_helix_gap_key,
]
def values(self) -> list[float]:
return [
self.rise_per_base_pair,
self.helix_radius,
self.bases_per_turn,
self.minor_groove_angle,
self.inter_helix_gap,
]
@staticmethod
def default_values() -> list[float]:
return _default_geometry.values()
def to_json_serializable(self, suppress_indent: bool = True, **kwargs: Any) -> dict[str, Any]:
dct: dict[str, Any] = OrderedDict()
for name, val, val_default in zip(Geometry.keys(), self.values(), Geometry.default_values()):
if val != val_default:
dct[name] = val
return dct
_default_geometry = Geometry()
[docs]
@dataclass
class Helix(_JSONSerializable):
"""
Represents a "helix" where :any:`Domain`'s could go. Technically a :any:`Helix` can contain no
:any:`Domain`'s. More commonly, some partial regions of it may have only 1 or 0 :any:`Domain`'s.
So it is best thought of as a "potential" double-helix.
It has a 1-dimensional integer coordinate system given by "offsets", integers between
:py:data:`Helix.min_offset` (inclusive) and :py:data:`Helix.max_offset` (exclusive).
At any valid offset for this :any:`Helix`, at most two :any:`Domain`'s may share that offset
on this :any:`Helix`, and if there are exactly two, then one must have
:py:data:`Domain.forward` = ``true`` and the other must have
:py:data:`Domain.forward` = ``false``.
Each :any:`Helix` has an index, accessible via :py:data:`Helix.idx`. By default this
is its order in the list of all :any:`Helix`'s (this is how the :any:`Design` constructor sets the
field if it is not already set), but it can be manually assigned to be any integer that is unique to the
:any:`Helix`. This index is how a :any:`Domain` is
associated to the :any:`Helix` via the field :any:`Domain.helix`.
"""
idx: int = -1
"""Index of this :any:`Helix`.
Optional if no other :any:`Helix` specifies a value for *idx*.
Default is the order of the :any:`Helix` is listed in constructor for :any:`Design`."""
grid_position: tuple[int, int] | None = None # type: ignore
"""`(h,v)` position of this helix in the side view grid,
if :const:`Grid.square`, :const:`Grid.hex` , or :const:`Grid.honeycomb` is used
in the :any:`Design` containing this helix.
`h` and `v` are in units of "helices": incrementing `h` moves right one helix in the grid
and incrementing `v` moves down one helix in the grid.
In the case of the hexagonal lattice,
The convention is that incrementing `v` moves down and to the right if h is even,
and moves down and to the left if `h` is odd.
This is the "odd-q" coordinate system here:
https://www.redblobgames.com/grids/hexagons/)
However, the default y position in the main view for helices does not otherwise depend on grid_position.
The default is to list the y-coordinates in order by helix idx.
Default is `h` = 0, `v` = index of :any:`Helix` in :py:data:`Design.helices`.
In the case of the honeycomb lattice, we use the same convention as cadnano for encoding hex coordinates,
see `misc/cadnano-format-specs/v2.txt`.
That convention is different from simply excluding coordinates from the hex lattice.
"""
max_offset: int | None = None # type: ignore
"""Maximum offset (exclusive) of :any:`Domain` that can be drawn on this :any:`Helix`.
Optional field.
If unspecified, it is calculated when the :any:`Design` is instantiated as
the largest :any:`Domain.end` offset of any :any:`Domain` in the design.
"""
min_offset: int = 0
"""Minimum offset (inclusive) of :any:`Domain` that can be drawn on this :any:`Helix`.
Optional field. Default value 0.
"""
major_tick_start: int | None = None # type: ignore
"""Offset of first major tick when not specifying :py:data:`Helix.major_ticks`.
Used in combination with either
:py:data:`Helix.major_tick_distance` or
:py:data:`Helix.major_tick_periodic_distances`.
Optional field.
If not specified, is initialized to value :py:data:`Helix.min_offset`."""
major_tick_distance: int | None = None
"""Distance between major ticks (bold) delimiting boundaries between bases. Major ticks will appear
in the visual interface at positions
Optional field.
If 0 then no major ticks are drawn.
If not specified then the default value is assumed.
If the grid is :any:`Grid.square` then the default value is 8.
If the grid is :any:`Grid.hex` or :any:`Grid.honeycomb` then the default value is 7."""
major_tick_periodic_distances: list[int] | None = None
"""Periodic distances between major ticks. For example, setting
:py:data:`Helix.major_tick_periodic_distances` = [2, 3] and
:py:data:`Helix.major_tick_start` = 10 means that major ticks will appear at
12,
15,
17,
20,
22,
25,
27,
30, ...
Optional field.
:py:data:`Helix.major_tick_distance` is equivalent to
the setting :py:data:`Helix.major_tick_periodic_distances` = [:py:data:`Helix.major_tick_distance`].
"""
major_ticks: list[int] | None = None # type: ignore
"""If not ``None``, overrides :any:`Helix.major_tick_distance`
to specify a list of offsets at which to put major ticks."""
position: Position3D | None = None # type: ignore
"""Position (x,y,z) of this :any:`Helix` in 3D space.
Must be None if :py:data:`Helix.grid_position` is specified."""
roll: float = 0
"""Angle around the center of the helix; 0 means pointing straight up in the side view.
Rotation is clockwise in the side view; the same convention as :data:`HelixGroup.roll`.
Units are degrees."""
group: str = default_group_name # type: ignore
"""Name of the :any:`HelixGroup` to which this :any:`Helix` belongs."""
# for optimization; list of domains on that Helix
_domains: list[Domain] = field(default_factory=list)
def __post_init__(self) -> None:
if self.major_tick_start is None: # type: ignore
self.major_tick_start = self.min_offset # type: ignore
if self.grid_position is not None and self.position is not None:
raise IllegalDesignError(
"exactly one of grid_position or position must be specified, but both are specified"
)
if self.major_ticks is not None and self.max_offset is not None and self.min_offset is not None:
for major_tick in self.major_ticks:
if major_tick > self.max_offset - self.min_offset:
raise IllegalDesignError(
f"major tick {major_tick} in list {self.major_ticks} is "
f"outside the range of available offsets since max_offset = "
f"{self.max_offset}"
)
def to_json_serializable(self, suppress_indent: bool = True, **kwargs: Any) -> dict[str, Any] | NoIndent:
dct: dict[str, Any] = dict()
dct[idx_on_helix_key] = self.idx
grid: Grid = kwargs["grid"]
# if we have major ticks or position, it's harder to read Helix on one line,
# so don't wrap it in NoIndent, but still wrap longer sub-objects in them
# use_no_indent_helix: bool = not (self.major_ticks is not None or self.position is not None)
use_no_indent_helix: bool = not (self.major_ticks is not None)
if self.group != default_group_name:
dct[group_key] = self.group
if not self.min_offset_is_default():
dct[min_offset_key] = self.min_offset
if not self.major_tick_start_is_default():
dct[major_tick_start_key] = self.major_tick_start
dct[max_offset_key] = self.max_offset
if self.position is None:
if grid == Grid.none:
raise IllegalDesignError("cannot have Helix.position == None when grid is None")
dct[grid_position_key] = (
NoIndent(self.grid_position) if suppress_indent and not use_no_indent_helix else self.grid_position
)
else:
if grid != Grid.none:
raise IllegalDesignError("cannot have Helix.position != None when grid is not None")
pos = self.position.to_json_serializable(suppress_indent)
dct[position_key] = NoIndent(pos) if suppress_indent and not use_no_indent_helix else pos
if not _is_close(self.roll, default_roll):
dct[roll_key] = self.roll
if not self.major_tick_distance_is_default(grid):
dct[major_tick_distance_key] = self.major_tick_distance
if not self.major_tick_periodic_distances_is_default():
dct[major_tick_periodic_distances_key] = (
NoIndent(self.major_tick_periodic_distances)
if suppress_indent and not use_no_indent_helix
else self.major_tick_periodic_distances
)
if not self.major_ticks_is_default():
dct[major_ticks_key] = (
NoIndent(self.major_ticks) if suppress_indent and not use_no_indent_helix else self.major_ticks
)
return NoIndent(dct) if suppress_indent and use_no_indent_helix else dct
@staticmethod
def from_json(json_map: dict) -> Helix:
grid_position: tuple[int, int] | None = None
if grid_position_key in json_map:
gp_list = json_map[grid_position_key]
if len(gp_list) == 3:
gp_list = gp_list[:2]
if len(gp_list) != 2:
raise IllegalDesignError(
f"list of grid_position coordinates must be length 2, but this is the list: {gp_list}"
)
grid_position = (gp_list[0], gp_list[1])
major_tick_distance = json_map.get(major_tick_distance_key)
major_ticks = json_map.get(major_ticks_key)
major_tick_start = json_map.get(major_tick_start_key)
major_tick_periodic_distances = json_map.get(major_tick_periodic_distances_key)
min_offset = optional_field(0, json_map, min_offset_key)
max_offset = json_map.get(max_offset_key)
idx = json_map.get(idx_on_helix_key, -1)
position_map = optional_field(None, json_map, position_key, legacy_keys=legacy_position_keys)
position = Position3D.from_json(position_map) if position_map is not None else None
roll = json_map.get(roll_key, default_roll)
group = json_map.get(group_key, default_group_name)
return Helix(
major_tick_distance=major_tick_distance,
major_ticks=major_ticks,
major_tick_start=major_tick_start,
major_tick_periodic_distances=major_tick_periodic_distances,
grid_position=grid_position,
min_offset=min_offset,
max_offset=max_offset,
position=position,
roll=roll,
idx=idx,
group=group,
)
def default_grid_position(self) -> tuple[int, int]:
if self.idx < 0:
raise IllegalDesignError(
"Helix idx must be non-negative to have a default grid position; "
"helices have default idx -1; be sure to set it explicitly"
)
return 0, self.idx
[docs]
def calculate_major_ticks(self, grid: Grid) -> list[int]:
"""
Calculates full list of major tick marks, whether using `default_major_tick_distance` (from
:any:`Design`), :py:data:`Helix.major_tick_distance`, or :py:data:`Helix.major_ticks`.
They are used in reverse order to determine precedence. (e.g., :py:data:`Helix.major_ticks`
overrides :py:data:`Helix.major_tick_distance`, which overrides
`default_major_tick_distance` from :any:`Design`.
"""
if self.max_offset is None:
raise ValueError("cannot calculate major ticks if max_offset is not specified")
if self.major_tick_start is None:
raise AssertionError("major_tick_start should never be None")
if self.major_ticks is not None:
return self.major_ticks
elif self.major_tick_distance is not None:
return list(range(self.major_tick_start, self.max_offset + 1, self.major_tick_distance))
elif self.major_tick_periodic_distances is not None:
ticks = []
tick = self.major_tick_start
idx_period = 0
while tick <= self.max_offset:
ticks.append(tick)
tick += self.major_tick_periodic_distances[idx_period]
idx_period = (idx_period + 1) % len(self.major_tick_periodic_distances)
return ticks
else:
distance = default_major_tick_distance(grid)
return list(range(self.major_tick_start, self.max_offset + 1, distance))
[docs]
def calculate_position(self, grid: Grid | None, geometry: Geometry | None = None) -> Position3D:
"""
:param grid:
:any:`Grid` of this :any:`Helix` used to interpret the field :data:`Helix.grid_position`.
Must be None if :data:`Helix.grid_position` is None.
:param geometry:
:any:`Geometry` parameters to determine distance between helices in a grid.
Must be None if :data:`Helix.grid_position` is None.
:return:
Position of this :any:`Helix` in 3D space, based on its :data:`Helix.grid_position`
if it is not None, or its :data:`Helix.position` otherwise.
"""
if self.grid_position is None:
assert grid == Grid.none
assert self.position is not None
return self.position
else:
assert grid is not None
assert geometry is not None
return grid_position_to_position(self.grid_position, grid, geometry)
@property
def domains(self) -> list[Domain]:
"""
Return :any:`Domain`'s on this :any:`Helix`.
Assigned when a :any:`Design` is created using this :any:`Helix`.
:return: :any:`Domain`'s on this helix
"""
return self._domains
def min_offset_is_default(self) -> bool:
return self.min_offset == 0
def major_tick_start_is_default(self) -> bool:
return self.major_tick_start == self.min_offset
def major_tick_distance_is_default(self, grid: Grid) -> bool:
return self.major_tick_distance is None or default_major_tick_distance(grid) == self.major_tick_distance
def major_tick_periodic_distances_is_default(self) -> bool:
return self.major_tick_periodic_distances is None
def major_ticks_is_default(self) -> bool:
return self.major_ticks is None
[docs]
def backbone_angle_at_offset(self, offset: int, forward: bool, geometry: Geometry) -> float:
"""
Computes the backbone angle at *offset* for the strand in the direction given by *forward*.
:param offset:
offset on this helix
:param forward:
whether to compute angle for the forward or reverse strand
:param geometry:
:any:`Geometry` parameters to determine bases per turn
:return:
backbone angle at *offset* for the strand in the direction given by *forward*.
"""
degrees_per_base = 360 / geometry.bases_per_turn
angle = self.roll + offset * degrees_per_base
if not forward:
angle += geometry.minor_groove_angle
angle %= 360
return angle
[docs]
def crossover_addresses(
self, helices: dict[int, Helix], allow_intrahelix: bool = True, allow_intergroup: bool = True
) -> list[tuple[int, int, bool]]:
"""
:param helices:
The dict of helices in which this :any:`Helix` is contained, that contains other helices
to which it might be connected by crossovers.
:param allow_intrahelix:
if ``False``, then do not return crossovers to the same :any:`Helix` as this :any:`Helix`
:param allow_intergroup:
if ``False``, then do not return crossovers to a :any:`Helix` in a different helix group
as this :any:`Helix`
:return:
list of triples (`helix_idx`, `offset`, `forward`) of all crossovers incident to this
:any:`Helix`, where `offset` is the offset of the crossover and `helix_idx` is the
:data:`Helix.idx` of the other :any:`Helix` incident to the crossover.
"""
def allow_crossover_to(helix2: Helix) -> bool:
if not allow_intrahelix and helix2.idx == self.idx:
return False
if not allow_intergroup and helix2.group != self.group:
return False
return True
addresses: list[tuple[int, int, bool]] = []
for domain in self.domains:
strand = domain.strand()
domains_on_strand = strand.bound_domains()
num_domains = len(domains_on_strand)
domain_idx = domains_on_strand.index(domain)
domain_idx_in_substrands = strand.domains.index(domain)
# if not first domain, then there is a crossover to the previous domain
if domain_idx > 0:
# ... unless there's a loopout between them
previous_substrand = strand.domains[domain_idx_in_substrands - 1]
if isinstance(previous_substrand, Domain):
offset = domain.offset_5p()
other_domain = domains_on_strand[domain_idx - 1]
assert previous_substrand == other_domain
other_helix_idx = other_domain.helix
other_helix = helices[other_helix_idx]
if allow_crossover_to(other_helix):
addresses.append((other_helix_idx, offset, domain.forward))
# if not last domain, then there is a crossover to the next domain
if domain_idx < num_domains - 1:
# ... unless there's a loopout between them
next_substrand = strand.domains[domain_idx_in_substrands + 1]
if isinstance(next_substrand, Domain):
offset = domain.offset_3p()
other_domain = domains_on_strand[domain_idx + 1]
assert next_substrand == other_domain
other_helix_idx = other_domain.helix
other_helix = helices[other_helix_idx]
if allow_crossover_to(other_helix):
addresses.append((other_helix_idx, offset, domain.forward))
return addresses
[docs]
def get_strand_sets(self) -> tuple[list[Domain], list[Domain]]:
"""
Separates the domain into two arrays of [staple strands, scaffold strands].
:return: A tuple containing the [stapSS, scafSS].
NOTE: This is a modified version of cadnano2's getStrandSets (virtualhelix.py)
https://github.com/douglaslab/cadnano2/blob/239ecc851407b64b44a8a4bdecdd5eb4848868f5/cadnano2/model/virtualhelix.py#L128C1-L131C14
"""
# On idx even, staple strands will go backwards.
# On idx even, scaffold strands will go forward.
stapSS = [
domain
for domain in self.domains
if (self.idx % 2 == 0 and not domain.forward) or (self.idx % 2 == 1 and domain.forward)
]
scafSS = [
domain
for domain in self.domains
if (self.idx % 2 == 0 and domain.forward) or (self.idx % 2 == 1 and not domain.forward)
]
return stapSS, scafSS
[docs]
def relax_roll(self, helices: dict[int, Helix], grid: Grid, geometry: Geometry) -> None:
"""
Like :meth:`Design.relax_helix_rolls`, but only for this :any:`Helix`.
"""
roll_delta = self.compute_relaxed_roll_delta(helices, grid, geometry)
self.roll += roll_delta
[docs]
def compute_relaxed_roll_delta(self, helices: dict[int, Helix], grid: Grid, geometry: Geometry) -> float:
"""
Like :meth:`Helix.relax_roll`, but just returns the amount by which to rotate the current roll,
without actually altering the field :data:`Helix.roll`.
"""
angles = []
addresses = self.crossover_addresses(helices, allow_intrahelix=False, allow_intergroup=False)
for helix_idx, offset, forward in addresses:
other_helix = helices[helix_idx]
angle_of_other_helix = angle_from_helix_to_helix(self, other_helix, grid, geometry)
crossover_angle = self.backbone_angle_at_offset(offset, forward, geometry)
relative_angle = (crossover_angle, angle_of_other_helix)
angles.append(relative_angle)
if len(angles) == 0:
angle = 0.0
else:
angle = minimum_strain_angle(angles)
return angle
[docs]
def angle_from_helix_to_helix(
helix: Helix, other_helix: Helix, grid: Grid | None = None, geometry: Geometry | None = None
) -> float:
"""
Computes angle between `helix` and `other_helix` in degrees.
:param helix:
first helix
:param other_helix:
second helix
:param grid:
:any:`Grid` to use when calculating Helix positions
:param geometry:
:any:`Geometry` to use when calculating Helix positions
:return:
angle between `helix` and `other_helix` in degrees.
"""
p1 = helix.calculate_position(grid, geometry)
p2 = other_helix.calculate_position(grid, geometry)
# negate y_diff because y increases going down in the main view
y_diff = -(p2.y - p1.y)
x_diff = p2.x - p1.x
angle = math.degrees(math.atan2(y_diff, x_diff))
# negate angle because we rotate clockwise
angle = -angle
# subtract 90 since we define 0 angle to be up instead of right
angle += 90
# normalize to be in range [0, 360)
angle %= 360
return angle
[docs]
def minimum_strain_angle(relative_angles: list[tuple[float, float]]) -> float:
r"""
Computes the angle that minimizes the "strain" of all relative angles in the given list.
A "relative angle" is a pair :math:`(\theta, \mu)`. The strain is set to 0 by setting
:math:`\theta = \mu`; more generally the strain is :math:`(\theta-\mu)^2`, where :math:`\theta-\mu`
is the "angular difference" (e.g., 10-350 is 20 since 350 is also -10 mod 360).
The constraint is that in the list
[:math:`(\theta_1, \mu_1)`, :math:`(\theta_2, \mu_2)`, ..., :math:`(\theta_n, \mu_n)`],
we can rotate all angles :math:`\theta_i` by the same amount :math:`\theta`.
So this calculates the angle :math:`\theta` that minimizes
:math:`\sum_i [(\theta + \theta_i) - \mu_i]^2`
:param relative_angles:
list of :math:`(\theta_i, \mu_i)` pairs, where :math:`\theta_i = \mu_i` means 0 strain, and angles
are in units of degrees.
:return:
angle :math:`\theta` by which to rotate all angles :math:`\theta_i`
(but not changing any "zero angle" :math:`\mu_i`)
such that :math:`\sum_i [(\theta + \theta_i) - \mu_i]^2` is minimized.
"""
if len(relative_angles) == 0:
raise ValueError("cannot find minimum strain angle unless relative_angles is nonempty")
adjusted_angles = [angle - zero_angle for angle, zero_angle in relative_angles]
ave_angle = average_angle(adjusted_angles)
min_strain_angle = -ave_angle
min_strain_angle %= 360
return min_strain_angle
[docs]
def angle_distance(x: float, y: float) -> float:
"""
:param x: angle in degrees
:param y: angle in degrees
:return: signed difference between angles `x` and `y`, in degrees, in range [-180, 180]
"""
a = (x - y) % 360
b = (y - x) % 360
diff = -a if a < b else b
return diff
[docs]
def sum_squared_angle_distances(angles: list[float], angle: float) -> float:
"""
:param angles: list of angles in degrees
:param angle: angle in degrees
:return: sum of squared distances from each angle in `angles` to `angle`
"""
return sum(angle_distance(angle, a) ** 2 for a in angles)
[docs]
def average_angle(angles: list[float]) -> float:
"""
Calculate the "circular mean" of the angles in `angles`. Note this coincides with the arithemtic mean
for certain lists of angles, e.g., [0, 10, 50], in a way that the circular mean calculated via
interpreting angles as unit vectors (https://en.wikipedia.org/wiki/Circular_mean) does not.
This algorithm is due to Julian Panetta. (https://julianpanetta.com/)
:param angles:
list of angles in degrees.
:return:
average angle of the list of angles, normalized to be between 0 and 360.
"""
num_angles = len(angles)
if num_angles == 0:
raise ValueError("cannot take average of empty list of angles")
mean_angle = sum(angles) / num_angles
min_dist = float("inf")
optimal_angle = 0
for n in range(num_angles):
candidate_angle = mean_angle + 360.0 * n / num_angles
candidate_dist = sum_squared_angle_distances(angles, candidate_angle)
if min_dist > candidate_dist:
min_dist = candidate_dist
optimal_angle = candidate_angle
optimal_angle %= 360.0
# taking mod 360 sometimes results in 360.0 instead of 0.0. This is hacky but fixes it.
if abs(360.0 - optimal_angle) < 10 ** (-8):
optimal_angle = 0.0
# in case it's a nice round number, let's get rid of the floating-point error artifacts here
optimal_angle = round(optimal_angle, 9)
return optimal_angle
def _is_close(x1: float, x2: float) -> bool:
return abs(x1 - x2) < _floating_point_tolerance
def _vendor_dna_sequence_substrand(substrand: Domain | Loopout | Extension) -> str | None:
# used to share code between Domain, Loopout Extension
# for adding modification codes to exported DNA sequence
if substrand.dna_sequence is None:
return None
strand = substrand.strand()
len_dna_prior = 0
for other_substrand in strand.domains:
if other_substrand is substrand:
break
len_dna_prior += other_substrand.dna_length()
new_seq_list = []
for pos, base in enumerate(substrand.dna_sequence):
new_seq_list.append(base)
strand_pos = pos + len_dna_prior
if strand_pos in strand.modifications_int: # if internal mod attached to base, replace base
mod = strand.modifications_int[strand_pos]
if mod.vendor_code is not None:
vendor_code_with_delim = mod.vendor_code
if mod.allowed_bases is not None:
if base not in mod.allowed_bases:
msg = (
f"internal modification {mod} can only replace one of these bases: "
f"{','.join(mod.allowed_bases)}, "
f"but the base at position {strand_pos} is {base}"
)
raise IllegalDesignError(msg)
new_seq_list[-1] = vendor_code_with_delim # replace base with modified base
else:
new_seq_list.append(vendor_code_with_delim) # append modification between two bases
return "".join(new_seq_list)
[docs]
@dataclass
class Domain(_JSONSerializable):
"""
A maximal portion of a :any:`Strand` that is continguous on a single :any:`Helix`.
A :any:`Strand` contains a list of :any:`Domain`'s (and also potentially :any:`Loopout`'s).
"""
helix: int
"""index of the :any:`Helix` on which this :any:`Domain` resides."""
forward: bool
"""Whether the strand "points" forward (i.e., its 3' end has a larger offset than its 5' end).
If :any:`Domain.forward` is ``True``, then
:any:`Domain.start` is the 5' end of the :any:`Domain` and
:any:`Domain.end` is the 3' end of the :any:`Domain`.
If :any:`Domain.forward` is ``False``, these roles are reversed."""
start: int
"""
The smallest offset position of any base on this Domain
(3' end if :any:`Domain.forward` = ``False``,
5' end if :any:`Domain.forward` = ``True``).
"""
end: int
"""
1 plus the largest offset position of any base on this Domain
(5' end if :any:`Domain.forward` = ``False``,
3' end if :any:`Domain.forward` = ``True``).
Note that the set of base offsets occupied by this Domain is {start, start+1, ..., end-1},
i.e., inclusive for :py:data:`Strand.start` but exclusive for :py:data:`Strand.end`,
the same convention used in Python for slices of lists and strings.
(e.g., :samp:`"abcdef"[1:3] == "bc"`)
Some methods (such as :py:meth:`Domain.dna_sequence_in`) use the convention of being inclusive on
both ends and are marked with the word "INCLUSIVE".
(Such a convention is easier to reason about when there are insertions and deletions.)
"""
deletions: list[int] = field(default_factory=list)
"""list of positions of deletions on this Domain."""
insertions: list[tuple[int, int]] = field(default_factory=list)
"""list of (position,num_insertions) pairs on this Domain.
This is the number of *extra* bases in addition to the base already at this position.
The total number of bases at this offset is num_insertions+1."""
name: str | None = None
"""Optional name to give this :any:`Domain`.
This is used to interoperate with the dsd DNA sequence design package."""
label: str | None = None
"""
This can be used to attach a "label" to associate to this :any:`Loopout`.
See :any:`Strand.label` for examples.
"""
dna_sequence: str | None = None
"""DNA sequence of this Domain, or ``None`` if no DNA sequence has been assigned
to this :any:`Domain`'s :any:`Strand`."""
color: Color | None = None
"""
Color to show this domain in the main view. If specified, overrides the field :data:`Strand.color`.
"""
# not serialized; for efficiency
_parent_strand: Strand | None = field(init=False, repr=False, compare=False, default=None)
def __post_init__(self) -> None:
self._check_start_end()
def to_json_serializable(self, suppress_indent: bool = True, **kwargs: Any) -> NoIndent | dict[str, Any]:
dct: dict[str, Any] = OrderedDict()
if self.name is not None:
dct[domain_name_key] = self.name
dct[helix_idx_key] = self.helix
dct[forward_key] = self.forward
dct[start_key] = self.start
dct[end_key] = self.end
if len(self.deletions) > 0:
dct[deletions_key] = self.deletions
if len(self.insertions) > 0:
dct[insertions_key] = self.insertions
if self.label is not None:
dct[domain_label_key] = self.label
if self.color is not None:
dct[color_key] = self.color.to_json_serializable(suppress_indent)
return NoIndent(dct) if suppress_indent else dct
@staticmethod
def from_json(json_map: dict[str, Any]) -> Domain:
helix = mandatory_field(Domain, json_map, helix_idx_key)
forward = mandatory_field(Domain, json_map, forward_key, legacy_keys=legacy_forward_keys)
start = mandatory_field(Domain, json_map, start_key)
end = mandatory_field(Domain, json_map, end_key)
deletions = json_map.get(deletions_key, [])
insertions = cast(
list[tuple[int, int]], # noqa
list(map(tuple, json_map.get(insertions_key, []))),
) # type: ignore
name = json_map.get(domain_name_key)
label = json_map.get(domain_label_key)
color_json = json_map.get(color_key)
color = Color.from_json(color_json)
return Domain(
helix=helix,
forward=forward,
start=start,
end=end,
deletions=deletions,
insertions=insertions,
name=name,
label=label,
color=color,
)
def __repr__(self) -> str:
rep = (
(
"Domain(" + (f"name={self.name}" if self.name is not None else "") + f", helix={self.helix}"
f", forward={self.forward}"
f", start={self.start}"
f", end={self.end}"
)
+ (f", deletions={self.deletions}" if len(self.deletions) > 0 else "")
+ (f", insertions={self.insertions}" if len(self.insertions) > 0 else "")
+ (f", color={self.color}" if self.color is not None else "")
+ ")"
)
return rep
def __str__(self) -> str:
return repr(self) if self.name is None else self.name
[docs]
def strand(self) -> Strand:
"""
:return: The :any:`Strand` that contains this :any:`Domain`.
"""
if self._parent_strand is None:
raise ValueError("_parent_strand has not yet been set")
return self._parent_strand
[docs]
def vendor_dna_sequence(self) -> str | None:
"""
:return:
vendor DNA sequence of this :any:`Domain`, or ``None`` if no DNA sequence has been assigned.
The difference between this and the field :data:`Domain.dna_sequence` is that this
will add internal modification codes.
"""
return _vendor_dna_sequence_substrand(self)
[docs]
def set_name(self, name: str) -> None:
"""Sets name of this :any:`Domain`."""
self.name = name
[docs]
def set_label(self, label: str) -> None:
"""Sets label of this :any:`Domain`."""
self.label = label
def _check_start_end(self) -> None:
if self.start >= self.end:
if self._parent_strand is None:
raise ValueError(
f"start = {self.start} must be less than end = {self.end}\n_parent_strand has not yet been set"
)
raise StrandError(self._parent_strand, f"start = {self.start} must be less than end = {self.end}")
# @staticmethod
# def is_loopout() -> bool:
# """Indicates if this is a :any:`Loopout` (always false)
# Useful when object could be either :any:`Loopout` or :any:`Domain`."""
# return False
#
# @staticmethod
# def is_domain() -> bool:
# """Indicates if this is a :any:`Domain` (always true)
# Useful when object could be either :any:`Loopout` or :any:`Domain`."""
# return True
def set_start(self, new_start: int) -> None:
self.start = new_start
self._check_start_end()
def set_end(self, new_end: int) -> None:
self.end = new_end
self._check_start_end()
[docs]
def offset_5p(self) -> int:
"""5' offset of this :any:`Domain`, INCLUSIVE."""
if self.forward:
return self.start
else:
return self.end - 1
# return self.start if self.forward else self.end - 1
[docs]
def offset_3p(self) -> int:
"""3' offset of this :any:`Domain`, INCLUSIVE."""
return self.end - 1 if self.forward else self.start
def _num_insertions(self) -> int:
# total number of insertions in this Domain
return sum(insertion[1] for insertion in self.insertions)
[docs]
def contains_offset(self, offset: int) -> bool:
"""Indicates if `offset` is the offset of a base on this :any:`Domain`.
Note that offsets refer to visual portions of the displayed grid for the Helix.
If for example, this Domain starts at position 0 and ends at 10, and it has 5 deletions,
then it contains the offset 7 even though there is no base 7 positions from the start."""
return self.start <= offset < self.end
def __len__(self) -> int:
"""Same as :meth:`Domain.dna_length`.
See also :meth:`Domain.visual_length`."""
return self.dna_length()
[docs]
def dna_length(self) -> int:
"""Number of bases in this Domain."""
return self.end - self.start - len(self.deletions) + self._num_insertions()
[docs]
def dna_length_in(self, left: int, right: int) -> int:
"""Number of bases in this Domain between offsets `left` and `right` (INCLUSIVE)."""
if not left <= right + 1:
raise ValueError(f"left = {left} and right = {right} but we should have left <= right + 1")
if not self.start <= left:
raise ValueError(f"left = {left} should be at least self.start = {self.start}")
if not right < self.end:
raise ValueError(f"right = {right} should be at most self.end - 1 = {self.end - 1}")
num_deletions = sum(1 for offset in self.deletions if left <= offset <= right)
num_insertions = sum(length for (offset, length) in self.insertions if left <= offset <= right)
return (right - left + 1) - num_deletions + num_insertions
[docs]
def visual_length(self) -> int:
"""Distance between :any:`Domain.start` offset and :any:`Domain.end` offset.
This can be more or less than the :meth:`Domain.dna_length` due to insertions and deletions."""
return self.end - self.start
[docs]
def dna_sequence_in(self, offset_left: int, offset_right: int) -> str | None:
"""Return DNA sequence of this Domain in the interval of offsets given by
[`offset_left`, `offset_right`], INCLUSIVE, or ``None`` if no DNA sequence has been assigned
to this :any:`Domain`'s :any:`Strand`.
WARNING: This is inclusive on both ends,
unlike other parts of this API where the right endpoint is exclusive.
This is to make the notion well-defined when one of the endpoints is on an offset with a
deletion or insertion."""
strand_seq = self._parent_strand.dna_sequence if self._parent_strand is not None else None
if strand_seq is None:
return None
# if on a deletion, move inward until we are off of it
while offset_left in self.deletions:
offset_left += 1
while offset_right in self.deletions:
offset_right -= 1
if offset_left > offset_right:
return ""
if offset_left >= self.end:
return ""
if offset_right < 0:
return ""
str_idx_left = self.domain_offset_to_strand_dna_idx(offset_left, self.forward)
str_idx_right = self.domain_offset_to_strand_dna_idx(offset_right, not self.forward)
if not self.forward: # these will be out of order if strand is left
str_idx_left, str_idx_right = str_idx_right, str_idx_left
subseq = strand_seq[str_idx_left : str_idx_right + 1]
return subseq
[docs]
def get_seq_start_idx(self) -> int:
"""Starting DNA subsequence index for first base of this :any:`Domain` on its
Parent :any:`Strand`'s DNA sequence."""
if self._parent_strand is None:
raise ValueError("should not call this method if a Strand has not be associated to this Domain")
domains = self._parent_strand.domains
# index of self in parent strand's list of domains
self_domain_idx = domains.index(self)
# index of self's position within the DNA sequence of parent strand
self_seq_idx_start = sum(prev_domain.dna_length() for prev_domain in domains[:self_domain_idx])
return self_seq_idx_start
[docs]
def domain_offset_to_strand_dna_idx(self, offset: int, offset_closer_to_5p: bool) -> int:
"""Convert from offset on this :any:`Domain`'s :any:`Helix`
to string index on the parent :any:`Strand`'s DNA sequence.
If `offset_closer_to_5p` is ``True``, (this only matters if `offset` contains an insertion)
then the only leftmost string index corresponding to this offset is included,
otherwise up to the rightmost string index (including all insertions) is included."""
if offset in self.deletions:
raise ValueError(f"offset {offset} illegally contains a deletion from {self.deletions}")
# length adjustment for insertions depends on whether this is a left or right offset
len_adjust = self._net_ins_del_length_increase_from_5p_to(offset, offset_closer_to_5p)
# get string index assuming this Domain is first on Strand
if self.forward:
offset += len_adjust # account for insertions and deletions
domain_str_idx = offset - self.start
else:
# account for insertions and deletions
offset -= len_adjust # account for insertions and deletions
domain_str_idx = self.end - 1 - offset
# correct for existence of previous Domains on this Strand
return domain_str_idx + self.get_seq_start_idx()
def _net_ins_del_length_increase_from_5p_to(self, offset_edge: int, offset_closer_to_5p: bool) -> int:
"""Net number of insertions from 5'/3' end to offset_edge,
INCLUSIVE on 5'/3' end, EXCLUSIVE on offset_edge.
Set `five_p` ``= False`` to test from 3' end to `offset_edge`."""
length_increase = 0
for deletion in self.deletions:
if self._between_5p_and_offset(deletion, offset_edge):
length_increase -= 1
for insertion_offset, insertion_length in self.insertions:
if self._between_5p_and_offset(insertion_offset, offset_edge):
length_increase += insertion_length
# special case for when offset_edge is an endpoint closer to the 3' end,
# we add its extra insertions also in this case
if not offset_closer_to_5p:
insertion_map: dict[int, int] = dict(self.insertions)
if offset_edge in insertion_map:
insertion_length = insertion_map[offset_edge]
length_increase += insertion_length
return length_increase
def _between_5p_and_offset(self, offset_to_test: int, offset_edge: int) -> bool:
return (self.forward and self.start <= offset_to_test < offset_edge) or (
not self.forward and offset_edge < offset_to_test < self.end
)
# def _between_3p_and_offset(self, offset_to_test: int, offset_edge: int) -> bool:
# return ((self.direction == Direction.left and self.start <= offset_to_test < offset_edge) or
# (self.direction == Direction.forward and offset_edge < offset_to_test < self.end))
[docs]
def overlaps(self, other: Domain) -> bool:
r"""Indicates if this :any:`Domain`'s set of offsets (the set
:math:`\{x \in \mathbb{N} \mid`
``self.start``
:math:`\leq x \leq`
``self.end``
:math:`\}`)
has nonempty intersection with those of `other`,
and they appear on the same helix,
and they point in opposite directions.""" # noqa (suppress PEP warning)
return self.forward == (not other.forward) and self.compute_overlap(other)[0] >= 0
[docs]
def find_overlapping_ranges(self, domains: list[Domain]) -> Generator[Domain, Any, None]:
"""
a binary search for the strands in self._strandList overlapping with
a query strands, or qstrands, indices.
Useful for operations on complementary strands such as applying a
sequence.
This is a generator for now.
NOTE: This function was translated from cadnano2's _findOverlappingRanges (strandset.py).
https://github.com/douglaslab/cadnano2/blob/239ecc851407b64b44a8a4bdecdd5eb4848868f5/cadnano2/model/strandset.py#L495C2-L603C14
"""
# Strategy:
# 1. search the _strandList for a strand the first strand that has a
# highIndex >= lowIndex of the query strand.
# save that strandSet index as sSetIndexLow.
# if No strand satisfies this condition, return an empty list
#
# Unless it matches the query strand's lowIndex exactly,
# Step 1 is O(log N) where N in length of self._strandList to the max,
# that is it needs to exhaust the search
#
# conversely you could search for first strand that has a
# lowIndex LESS than or equal to the lowIndex of the query strand.
#
# 2. starting at self._strandList[sSetIndexLow] test each strand to see if
# it's indexLow is LESS than or equal to qstrand.indexHigh. If it is
# yield/return that strand. If it's GREATER than the indexHigh, or
# you run out of strands to check, the generator terminates
domainList = domains
lenDomains = len(domainList)
if lenDomains == 0:
return
low = 0
high = lenDomains
# Dummyforward and DummyBackward should ahve the same start and end.
qLow = self.start
qHigh = self.end - 1 # inclusive on cadnano2, exclusive scadnano
# Step 1: get rangeIndexLow with a binary search
sSetIndexLow = -1
while low < high:
mid = (low + high) // 2
midDomain = domainList[mid]
# pre get indices from the currently tested strand
mLow = midDomain.start
mHigh = midDomain.end - 1
if mHigh == qLow:
# match, break out of while loop
sSetIndexLow = mid
break
elif mHigh > qLow:
# store the candidate index
sSetIndexLow = mid
# adjust the high index to find a better candidate if
# it exists
high = mid
# end elif
else: # mHigh < qLow
# If a strand exists it must be a higher rangeIndex
# leave the high the same
low = mid + 1
# end elif
# end while
# Step 2: create a generator on matches
# match on whether the tempStrand's lowIndex is
# within the range of the qStrand
if sSetIndexLow > -1:
tempDomains = iter(domainList[sSetIndexLow:])
tempDomain = next(tempDomains)
qHigh += 1 # bump it up for a more efficient comparison
i = 0 # use this to
while tempDomain and tempDomain.start < qHigh:
yield tempDomain
# use a next and a default to cause a break condition
tempDomain = next(tempDomains, None)
i += 1
# end while
# cache the last index we left of at
i = sSetIndexLow + i
"""
if
1. we ran out of strands to test adjust
OR
2. the end condition tempStrands highIndex is still inside the
qstrand but not equal to the end point
adjust i down 1
otherwise
"""
if not tempDomain or tempDomain.end < qHigh - 1:
i -= 1
# assign cache but double check it's a valid index
# self._lastStrandSetIndex = i if -1 < i < lenStrands else None
return
else:
# no strand was found
# go ahead and clear the cache
# self._lastStrandSetIndex = None if len(self._strandList) > 0 else 0
# TODO: For scadnano, I did not implement caching.
return
[docs]
def has_crossover_at(self, idx: int) -> bool:
"""
An xover is necessarily at an enpoint of a strand
NOTE: This is translated from cadnano2's hasXoverAt (strand.py)
https://github.com/douglaslab/cadnano2/blob/239ecc851407b64b44a8a4bdecdd5eb4848868f5/cadnano2/model/strand.py#L472C1-L482C14
"""
# In strand.py of cadnano2, it has the stuff commented out below.
# Check every strand, every domain, and if isinstance domain is true, that it is not an extension or loopout
# Base case, because "crossovers are *necessarily* at an enpoint of a strand"
if self.start == idx or self.end == idx:
return True
if self.is_5p_domain():
return self.offset_3p() == idx and self.strand().has_multiple_bound_domains()
# will have xover if idx is 3prime end
# cadnano represents xovers as some kind of object.
# This is true as long as there is some domain on the same strand
# if domain.is_3p_domain():
return self.offset_5p() == idx and self.strand().has_multiple_bound_domains()
def is5to3(self) -> bool:
isScaf = self.strand().is_scaffold
isEven = self.helix % 2 == 0
return isEven == isScaf
# def overlaps_illegally(self, other: Domain):
[docs]
def overlaps_illegally(self, other: Domain) -> bool:
r"""Indicates if this :any:`Domain`'s set of offsets (the set
:math:`\{x \in \mathbb{N} \mid`
``self.start``
:math:`\leq x \leq`
``self.end``
:math:`\}`)
has nonempty intersection with those of `other`,
and they appear on the same helix,
and they point in the same direction.""" # noqa (suppress PEP warning)
return self.forward == other.forward and self.compute_overlap(other)[0] >= 0
[docs]
def compute_overlap(self, other: Domain) -> tuple[int, int]:
"""Return [left,right) offset indicating overlap between this Domain and `other`.
Return ``(-1,-1)`` if they do not overlap (different helices, or non-overlapping regions
of the same helix)."""
if self.helix != other.helix:
return -1, -1
overlap_start = max(self.start, other.start)
overlap_end = min(self.end, other.end)
if overlap_start >= overlap_end: # overlap is empty
return -1, -1
return overlap_start, overlap_end
[docs]
def insertion_offsets(self) -> list[int]:
"""Return offsets of insertions (but not their lengths)."""
return [ins_off for (ins_off, _) in self.insertions]
[docs]
def is_extreme_domain(self, five_prime: bool) -> bool:
"""
:param five_prime:
whether to ask about 5' end or 3' end
:return:
Whether this :any:`Domain` is the 5' or 3' most :any:`Domain` on its :any:`Strand`.
(which depends on parameter `five_prime`
"""
if self._parent_strand is None:
end = "5'" if five_prime else "3'"
raise ValueError(f"cannot tell if this Domain is {end} since it is not yet assigned to a Strand")
idx = 0 if five_prime else -1
return self == self._parent_strand.domains[idx]
[docs]
def is_5p_domain(self) -> bool:
"""
:return:
Whether this :any:`Domain` is the 5' most :any:`Domain` on its :any:`Strand`.
"""
return self.is_extreme_domain(True)
[docs]
def is_3p_domain(self) -> bool:
"""
:return:
Whether this :any:`Domain` is the 3' most :any:`Domain` on its :any:`Strand`.
"""
return self.is_extreme_domain(False)
[docs]
@dataclass
class Loopout(_JSONSerializable):
"""Represents a single-stranded loopout on a :any:`Strand`.
One could think of a :any:`Loopout` as a type of :any:`Domain`, but none of the fields of
:any:`Domain` make sense for :any:`Loopout`, so they are not related to each other in the type
hierarchy. It is interpreted that a :any:`Loopout` is a single-stranded region bridging two
:any:`Domain`'s that are connected to :any:`Helix`'s.
It is illegal for two consecutive :any:`Domain`'s to both
be :any:`Loopout`'s,
or for a :any:`Loopout` to occur on either end of the :any:`Strand`
(i.e., each :any:`Strand` must begin and end with a :any:`Domain` or :any:`Extension`).
For example, one use of a loopout is to describe a hairpin (a.k.a.,
`stem-loop <https://en.wikipedia.org/wiki/Stem-loop>`_).
The following creates a :any:`Strand` that represents a hairpin with a stem length of 10 and a loop
length of 5.
.. code-block:: Python
import scadnano as sc
domain_f = sc.Domain(helix=0, forward=True, start=0, end=10)
loop = sc.Loopout(length=5)
domain_r = sc.Domain(helix=0, forward=False, start=0, end=10)
hairpin = sc.Strand([domain_f, loop, domain_r])
It can also be created with chained method calls
.. code-block:: Python
import scadnano as sc
design = sc.Design(helices=[sc.Helix(max_offset=10)])
design.draw_strand(0,0).move(10).loopout(0,5).move(-10)
"""
length: int
"""Length (in DNA bases) of this :any:`Loopout`."""
name: str | None = None
"""
Optional name to give this :any:`Loopout`.
This is used to interoperate with the dsd DNA sequence design package.
"""
label: str | None = None
"""
This can be used to attach a "label" to associate to this :any:`Loopout`.
See :any:`Strand.label` for examples.
"""
dna_sequence: str | None = None
"""DNA sequence of this :any:`Loopout`, or ``None`` if no DNA sequence has been assigned."""
color: Color | None = None
"""
Color to show this loopout in the main view. If specified, overrides the field :data:`Strand.color`.
"""
# not serialized; for efficiency
_parent_strand: Strand | None = field(init=False, repr=False, compare=False, default=None)
def to_json_serializable(self, suppress_indent: bool = True, **kwargs: Any) -> dict[str, Any] | NoIndent:
dct: dict[str, Any] = {loopout_key: self.length}
if self.name is not None:
dct[domain_name_key] = self.name
if self.label is not None:
dct[domain_label_key] = self.label
if self.color is not None:
dct[color_key] = self.color.to_json_serializable(suppress_indent)
return NoIndent(dct) if suppress_indent else dct
@staticmethod
def from_json(json_map: dict[str, Any]) -> Loopout:
# XXX: this should never fail since we detect whether to call this from_json by the presence
# of a length key in json_map
length_str = mandatory_field(Loopout, json_map, loopout_key)
length = int(length_str)
name = json_map.get(domain_name_key)
label = json_map.get(domain_label_key)
color_json = json_map.get(color_key)
color = Color.from_json(color_json)
return Loopout(length=length, name=name, label=label, color=color)
[docs]
def strand(self) -> Strand:
"""
:return: The :any:`Strand` that contains this :any:`Loopout`.
"""
if self._parent_strand is None:
raise ValueError("_parent_strand has not yet been set")
return self._parent_strand
def __repr__(self) -> str:
return (
"Loopout("
+ (f"{self.name}, " if self.name is not None else "")
+ f"{self.length}, "
+ (f"{self.label}, " if self.label is not None else "")
+ ")"
)
def __str__(self) -> str:
return repr(self) if self.name is None else self.name
[docs]
def vendor_dna_sequence(self) -> str | None:
"""
:return:
vendor DNA sequence of this :any:`Loopout`, or ``None`` if no DNA sequence has been assigned.
The difference between this and the field :data:`Loopout.dna_sequence` is that this
will add internal modification codes.
"""
return _vendor_dna_sequence_substrand(self)
[docs]
def set_name(self, name: str) -> None:
"""Sets name of this :any:`Loopout`."""
self.name = name
[docs]
def set_label(self, label: str | None) -> None:
"""Sets label of this :any:`Loopout`."""
self.label = label
def __len__(self) -> int:
"""Same as :any:`Loopout.dna_length`"""
return self.dna_length()
[docs]
def dna_length(self) -> int:
"""Length of this :any:`Loopout`; same as field :py:data:`Loopout.length`."""
return self.length
[docs]
def get_seq_start_idx(self) -> int:
"""Starting DNA subsequence index for first base of this :any:`Loopout` on its
:any:`Strand`'s DNA sequence."""
if self._parent_strand is None:
raise ValueError("_parent_strand has not been set")
domains = self._parent_strand.domains
# index of self in parent strand's list of domains
self_domain_idx = domains.index(self)
# index of self's position within the DNA sequence of parent strand
self_seq_idx_start = sum(prev_domain.dna_length() for prev_domain in domains[:self_domain_idx])
return self_seq_idx_start
default_display_angle = 35.0
default_display_length = 1.0
[docs]
@dataclass
class Extension(_JSONSerializable):
# using raw string literal for docstring to avoid warning about backslash
r"""Represents a single-stranded extension on either the 3' or 5'
end of :any:`Strand`.
One could think of an :any:`Extension` as a type of :any:`Domain`, but none of the fields of
:any:`Domain` make sense for :any:`Extension`, so they are not related to each other in the type
hierarchy. It is interpreted that an :any:`Extension` is a single-stranded region that resides on either
the 3' or 5' end of the :any:`Strand`. It is illegal for an :any:`Extension` to be placed
in the middle of the :any:`Strand` or for an :any:`Extension` to be adjacent to a :any:`Loopout`.
.. code-block:: Python
import scadnano as sc
domain = sc.Domain(helix=0, forward=True, start=0, end=10)
left_toehold = sc.Extension(num_bases=3)
right_toehold = sc.Extension(num_bases=2)
strand = sc.Strand([left_toehold, domain, right_toehold])
It can also be created with chained method calls
.. code-block:: Python
import scadnano as sc
design = sc.Design(helices=[sc.Helix(max_offset=10)])
design.draw_strand(0,0).extension_5p(3).move(10).extension_3p(2)
which makes this strand with :any:`Extension`'s on each side of the length-10 :any:`Domain`:
.. code-block:: none
[
\ >
\ /
\ /
----------
"""
num_bases: int
"""Length (in DNA bases) of this :any:`Extension`."""
display_length: float = default_display_length
"""
Length (in nm) to display the line representing the :any:`Extension` in the scadnano web app.
"""
display_angle: float = default_display_angle
"""
Angle (in degrees) to display in the scadnano web app.
This angle is relative to the "rotation frame" of the adjacent domain.
0 degrees means parallel to the adjacent domain.
90 degrees means pointing away from the helix.
180 degrees means means antiparallel to the adjacent domain (overlapping).
If a forward strand, will go above the strand; if a reverse strand, will go below,
for degrees strictly between 0 and 180.
"""
label: str | None = None
"""
This can be used to attach a "label" to associate to this :any:`Extension`.
See :any:`Strand.label` for examples.
"""
name: str | None = None
"""
Optional name to give this :any:`Extension`.
"""
dna_sequence: str | None = None
"""DNA sequence of this :any:`Extension`, or ``None`` if no DNA sequence has been assigned."""
color: Color | None = None
"""
Color to show this extension in the main view. If specified, overrides the field :data:`Strand.color`.
"""
# not serialized; for efficiency
_parent_strand: Strand | None = field(init=False, repr=False, compare=False, default=None)
def to_json_serializable(self, suppress_indent: bool = True, **kwargs: Any) -> dict[str, Any] | NoIndent:
json_map: dict[str, Any] = {extension_key: self.num_bases}
self._add_display_length_if_not_default(json_map)
self._add_display_angle_if_not_default(json_map)
self._add_name_if_not_default(json_map)
self._add_label_if_not_default(json_map)
if self.color is not None:
json_map[color_key] = self.color.to_json_serializable(suppress_indent)
return NoIndent(json_map) if suppress_indent else json_map
[docs]
def dna_length(self) -> int:
"""Length of this :any:`Extension`; same as field :data:`Extension.num_bases`."""
return self.num_bases
[docs]
def strand(self) -> Strand:
"""
:return: The :any:`Strand` that contains this :any:`Extension`.
"""
if self._parent_strand is None:
raise ValueError("_parent_strand has not yet been set")
return self._parent_strand
[docs]
def adjacent_domain(self) -> Domain:
"""
:return: The :any:`Domain` adjacent to this :any:`Extension` on the same :any:`Strand`.
Raises ValueError if no parent strand has been set
"""
strand = self.strand()
if self is strand.domains[0]:
first = True
elif self is strand.domains[-1]:
first = False
else:
raise ValueError(f"Extension {self} is on its parent Strand {strand}")
domain = strand.domains[1] if first else strand.domains[-2]
assert isinstance(domain, Domain)
return domain
[docs]
def vendor_dna_sequence(self) -> str | None:
"""
:return:
vendor DNA sequence of this :any:`Extension`, or ``None`` if no DNA sequence has been assigned.
The difference between this and the field :data:`Extension.dna_sequence` is that this
will add internal modification codes.
"""
return _vendor_dna_sequence_substrand(self)
[docs]
def set_label(self, label: str | None) -> None:
"""Sets label of this :any:`Extension`."""
self.label = label
[docs]
def set_name(self, name: str) -> None:
"""Sets name of this :any:`Extension`."""
self.name = name
@staticmethod
def from_json(json_map: dict[str, Any]) -> "Extension":
def float_transformer(x):
return float(x)
num_bases_str = mandatory_field(Extension, json_map, extension_key)
num_bases = int(num_bases_str)
display_length = optional_field(
_default_extension.display_length, json_map, display_length_key, transformer=float_transformer
)
display_angle = optional_field(
_default_extension.display_angle, json_map, display_angle_key, transformer=float_transformer
)
name = json_map.get(domain_name_key)
label = json_map.get(domain_label_key)
color_json = json_map.get(color_key)
color = Color.from_json(color_json)
return Extension(
num_bases=num_bases,
display_length=display_length,
display_angle=display_angle,
label=label,
name=name,
color=color,
)
def _add_display_length_if_not_default(self, json_map) -> None:
self._add_key_value_to_json_map_if_not_default(
key=display_length_key, value_callback=lambda x: x.display_length, json_map=json_map
)
def _add_display_angle_if_not_default(self, json_map) -> None:
self._add_key_value_to_json_map_if_not_default(
key=display_angle_key, value_callback=lambda x: x.display_angle, json_map=json_map
)
def _add_name_if_not_default(self, json_map) -> None:
self._add_key_value_to_json_map_if_not_default(
key=domain_name_key, value_callback=lambda x: x.name, json_map=json_map
)
def _add_label_if_not_default(self, json_map) -> None:
self._add_key_value_to_json_map_if_not_default(
key=domain_label_key, value_callback=lambda x: x.label, json_map=json_map
)
def _add_key_value_to_json_map_if_not_default(
self, key: str, value_callback: Callable[["Extension"], Any], json_map: dict[str, Any]
) -> None:
if value_callback(self) != value_callback(_default_extension):
json_map[key] = value_callback(self)
# Default Extension object to allow for access to default extension values. num_bases is a dummy.
_default_extension: Extension = Extension(num_bases=5)
_rctable = str.maketrans("ACGTacgt", "TGCAtgca")
[docs]
def rc(seq: str) -> str:
"""
Return reverse complement of `seq`.
For example, ``rc('AACCTG')`` returns ``'CAGGTT'``.
:param seq: a DNA sequence
:return: reverse complement of `seq`.
"""
return seq.translate(_rctable)[::-1]
[docs]
def wc(seq: str) -> str:
"""
Alias for :func:`rc`.
.. deprecated:: 0.20.0
Use :func:`rc` instead.
:param seq: a DNA sequence
:return: reverse complement of `seq`.
"""
return rc(seq)
[docs]
@dataclass
class VendorFields(_JSONSerializable):
"""
Data required when ordering DNA strands from a synthesis company.
These fields were originally designed for `IDT (Integrated DNA Technologies) <https://www.idtdna.com/>`_
and the default values for :data:`VendorFields.scale` and :data:`VendorFields.purification` reflect that.
However, most vendors have the same concepts of scale, purification, a code to specify the modification
(the field :data:`VendorFields.vendor_code`),
etc., so we use this generic class for any of them. Currently only IDT is supported by methods to
automatically export DNA sequences in the format IDT recognizes, but one should be able to write custom
code to export other formats that reads the fields in this object.
When exporting to IDT files via :py:meth:`Design.write_idt_plate_excel_file`
or :meth:`Design.write_idt_bulk_input_file`, the field :data:`Strand.name` is used for the
name if it exists, otherwise a reasonable default is chosen.
"""
scale: str = default_vendor_scale
"""
Synthesis scale at which to synthesize the strand (third field in IDT bulk input:
https://www.idtdna.com/site/order/oligoentry).
Choices supplied by IDT at the time this was written:
``"25nm"``, ``"100nm"``, ``"250nm"``, ``"1um"``, ``"5um"``,
``"10um"``, ``"4nmU"``, ``"20nmU"``, ``"PU"``, ``"25nmS"``.
"""
purification: str = default_vendor_purification
"""
Purification options (fourth field in IDT bulk input:
https://www.idtdna.com/site/order/oligoentry).
Choices supplied by IDT at the time this was written:
``"STD"``, ``"PAGE"``, ``"HPLC"``, ``"IEHPLC"``, ``"RNASE"``, ``"DUALHPLC"``, ``"PAGEHPLC"``.
"""
plate: str | None = None
"""
Name of plate in case this strand will be ordered on a 96-well or 384-well plate.
Optional field, but non-optional if :data:`VendorFields.well` is not ``None``.
"""
well: str | None = None
"""
Well position on plate in case this strand will be ordered on a 96-well or 384-well plate.
Well position on plate in case this strand will be ordered on a 96-well or 384-well plate.
Optional field, but non-optional if :data:`VendorFields.plate` is not ``None``.
"""
def __post_init__(self) -> None:
_check_vendor_string_not_none_or_empty(self.scale, "scale")
_check_vendor_string_not_none_or_empty(self.purification, "purification")
if self.plate is None and self.well is not None:
raise IllegalDesignError(
f"VendorFields.plate cannot be None if VendorFields.well is not None\nVendorFields.well = {self.well}"
)
if self.plate is not None and self.well is None:
raise IllegalDesignError(
f"VendorFields.well cannot be None if VendorFields.plate is not None\nVendorFields.plate = {self.plate}"
)
def to_json_serializable(self, suppress_indent: bool = True, **kwargs: Any) -> NoIndent | dict[str, Any]:
dct: dict[str, Any] = dict(self.__dict__)
if self.plate is None:
del dct["plate"]
if self.well is None:
del dct["well"]
return NoIndent(dct) if suppress_indent else dct
@staticmethod
def from_json(json_map: dict[str, Any]) -> VendorFields:
scale = mandatory_field(VendorFields, json_map, vendor_scale_key)
purification = mandatory_field(VendorFields, json_map, vendor_purification_key)
plate = json_map.get(vendor_plate_key)
well = json_map.get(vendor_well_key)
return VendorFields(scale=scale, purification=purification, plate=plate, well=well)
def _check_vendor_string_not_none_or_empty(value: str, field_name: str) -> None:
if value is None:
raise IllegalDesignError(f"field {field_name} in VendorFields cannot be None")
if len(value) == 0:
raise IllegalDesignError(f"field {field_name} in VendorFields cannot be empty")
[docs]
@dataclass
class StrandBuilder:
"""
Represents a :any:`Strand` that is being built in an existing :any:`Design`.
This is an intermediate object created when using chained method building by calling
:py:meth:`Design.draw_strand`, for example
.. code-block:: Python
design.draw_strand(0, 0).to(10).cross(1).to(5).with_modification_5p(mod.biotin_5p).as_scaffold()
:any:`StrandBuilder` should generally not be created directly by calling its constructor,
but rather by calling the method :meth:`Design.draw_strand`.
Although it is convenient to use chained method calls, it is also sometimes useful to assign the
:any:`StrandBuilder` object into a variable and then call the methods on that variable, particularly
when creating a strand with many domains that are easiest to express in a Python loop (e.g., a long
scaffold strand for a DNA origami). For example, the following code is equivalent to the above line:
.. code-block:: Python
sb = design.draw_strand(0, 0)
sb.to(10)
sb.cross(1)
sb.to(5)
sb.with_modification_5p(mod.biotin_5p)
sb.as_scaffold()
This is also useful if you create strands in a loop and want to call some of the methods conditionally.
For example to create many strands where only the first has a particular modification:
.. code-block:: Python
for i in range(n):
sb = design.draw_strand(0, 10).move(10).with_name(f'strand {i}')
if i == 0:
sb.with_modification_5p(mod.biotin_5p)
"""
design: Design
"""
The :any:`Design` in which this :any:`StrandBuilder` is building a :any:`Strand`.
"""
current_helix: int
"""
The current :any:`Helix` on which the next domain will be placed.
"""
current_offset: int
"""
The current offset on the current :any:`Helix` at which the next domain will be placed.
If the next domain is drawn as reverse (e.g., by calling :meth:`StrandBuilder.move` with a negative
relative offset), then :data:`current_offset` will be the :data:`Domain.end` offset of the next domain,
otherwise it will be the :data:`Domain.start` offset of the next domain.
"""
_strand: Strand | None = None
last_domain: Domain | None = None
"""
The last :any:`Domain` that was added to the :any:`Strand` being built by this :any:`StrandBuilder`.
Is None if no domains have been added yet.
"""
def __init__(self, design: Design, helix: int, offset: int):
self.design = design
self.current_helix = helix
self.current_offset = offset
@property
def strand(self) -> Strand:
"""
The :any:`Strand` that is being built by this :any:`StrandBuilder`.
The :any:`Strand` is created when the first domain is added to the :any:`StrandBuilder` by calling
either :meth:`StrandBuilder.to` or :meth:`StrandBuilder.move`; prior to that, calling this method
will raise an exception.
"""
if self._strand is None:
raise ValueError("no Strand created yet; make at least one domain first")
return self._strand
[docs]
def cross(self, helix: int, offset: int | None = None, move: int | None = None) -> StrandBuilder:
"""
Add crossover. To have any effect, must be followed by call to :meth:`StrandBuilder.to`
or :meth:`StrandBuilder.move`.
:param helix: :any:`Helix` to crossover to
:param offset: new offset on `helix`. If not specified, defaults to current offset.
(i.e., a "vertical" crossover)
Mutually excusive with `move`.
:param move:
Relative distance to new offset on `helix` from current offset.
If not specified, defaults to using parameter `offset`.
Mutually excusive with `offset`.
:return: self
"""
if helix not in self.design.helices:
helix_idxs_str = ", ".join(str(idx) for idx in self.design.helices.keys())
raise IllegalDesignError(
f"cannot cross to helix {helix} since it does not exist;\nvalid helix indices: {helix_idxs_str}"
)
if self._strand is None:
raise ValueError(
"cannot cross because no Strand created yet; make at least one domain first using move() or to()"
)
if self._most_recently_added_substrand_is_extension():
raise IllegalDesignError("Cannot cross after an extension.")
if move is not None and offset is not None:
raise IllegalDesignError(f"move and offset cannot both be specified:\nmove: {move}\noffset: {offset}")
self.last_domain = None
self.current_helix = helix
if offset is not None:
self.current_offset = offset
elif move is not None:
self.current_offset += move
return self
def _most_recently_added_substrand_is_instance_of_class(self, cls: Type) -> bool:
assert self._strand is not None
return isinstance(self._strand.domains[-1], cls)
def _most_recently_added_substrand_is_extension(self):
return self._most_recently_added_substrand_is_instance_of_class(Extension)
[docs]
def loopout(self, helix: int, length: int, offset: int | None = None, move: int | None = None) -> StrandBuilder:
"""
Like :py:meth:`StrandBuilder.cross`, but creates a :any:`Loopout` instead of a crossover.
:param helix: :any:`Helix` to crossover to
:param length: length of :any:`Loopout` to add
:param offset: new offset on `helix`. If not specified, defaults to current offset.
(i.e., a "vertical" loopout)
Mutually excusive with `move`.
:param move:
Relative distance to new offset on `helix` from current offset.
If not specified, defaults to using parameter `offset`.
Mutually excusive with `offset`.
:return: self
"""
if helix not in self.design.helices:
helix_idxs_str = ", ".join(str(idx) for idx in self.design.helices.keys())
raise IllegalDesignError(
f"cannot loopout to helix {helix} since it does not exist;\nvalid helix indices: {helix_idxs_str}"
)
if self._strand is None:
raise ValueError(
"cannot loopout because no Strand created yet; make at least one domain first using move() or to()"
)
self.cross(helix, offset=offset, move=move)
self.design.append_domain(self._strand, Loopout(length))
return self
[docs]
def extension_3p(
self,
num_bases: int,
display_length: float = default_display_length,
display_angle: float = default_display_angle,
) -> StrandBuilder:
"""
Creates an :any:`Extension` after verifying that it is valid to add an :any:`Extension` to
the :any:`Strand` as a 3' :any:`Extension`.
:param num_bases: number of bases of :any:`Extension` to add
:param display_length: display length of :any:`Extension` to add
:param display_angle: display angle of :any:`Extension` to add
:return: self
"""
self._verify_extension_3p_is_valid()
assert self._strand is not None
ext: Extension = Extension(num_bases=num_bases, display_length=display_length, display_angle=display_angle)
self.design.append_domain(self._strand, ext)
return self
def _verify_extension_3p_is_valid(self):
if self._strand is None:
raise IllegalDesignError(
"Cannot add a 3' extension when there are no domains. Did you mean to create a 5' extension?"
)
if self._most_recently_added_substrand_is_loopout():
raise IllegalDesignError("Cannot add a 3' extension immediately after a loopout.")
if self._most_recently_added_substrand_is_extension_3p():
raise IllegalDesignError("Cannot add a 3' extension after another 3' extension.")
self._verify_strand_is_not_circular()
def _verify_strand_is_not_circular(self):
assert self._strand is not None
if self._strand.circular:
raise IllegalDesignError("Cannot add an extension to a circular strand.")
def _most_recently_added_substrand_is_loopout(self):
return self._most_recently_added_substrand_is_instance_of_class(Loopout)
[docs]
def extension_5p(
self,
num_bases: int,
display_length: float = default_display_length,
display_angle: float = default_display_angle,
) -> StrandBuilder:
"""
Creates an :any:`Extension` after verifying that it is valid to add an :any:`Extension` to
the :any:`Strand` as a 5' :any:`Extension`.
:param num_bases: number of bases of :any:`Extension` to add
:param display_length: display length of :any:`Extension` to add
:param display_angle: display angle of :any:`Extension` to add
:return: self
"""
self._verify_extension_5p_is_valid()
ext: Extension = Extension(num_bases=num_bases, display_length=display_length, display_angle=display_angle)
self._strand = Strand(domains=[ext])
self.design.add_strand(self._strand)
return self
def _verify_extension_5p_is_valid(self):
if self._strand is not None:
raise IllegalDesignError(
"Cannot add a 5' extension when there are already domains. Did you mean to create a 3' extension?"
)
[docs]
def move(self, delta: int) -> StrandBuilder:
"""
Extends this :any:`StrandBuilder` on the current helix to offset given by the current offset
plus `delta`, which adds a new :any:`Domain` to the :any:`Strand` being built. This is a
"relative move", whereas :py:meth:`StrandBuilder.to` and :py:meth:`StrandBuilder.update_to`
are "absolute moves".
**NOTE**: The parameter `delta` does not indicate how much we move from the current offset.
It indicates the total length of the domain after the move. For instance, if we are currently
on offset 10, and we call ``move(5)``, this will create a domain starting at offset 10 and ending
at offset 14, for a total length of 5, occuping 5 offsets: 10, 11, 12, 13, 14. (But if we imagine
moving from offset 10, we've only moved by 4 offsets to arrive at 14, not 5 offsets.)
This updates the underlying :any:`Design` with a new :any:`Domain`,
and if :py:meth:`StrandBuilder.loopout` was last called on this :any:`StrandBuilder`,
also a new :any:`Loopout`.
If two instances of :py:meth:`StrandBuilder.move` are chained together, this creates two domains
on the same helix. The two offsets must move in the same direction. In other words, if we call
``.move(o1).move(o2)``, then ``o1`` and ``o2`` must be either both negative or both positive.
:param delta:
Distance to new offset to extend to, compared to current offset.
If less than current offset, the new :any:`Domain` is reverse, otherwise it is forward.
:return: self
"""
return self.to(self.current_offset + delta)
[docs]
def to(self, offset: int) -> StrandBuilder:
"""
Extends this :any:`StrandBuilder` on the current helix to offset `offset`,
which adds a new :any:`Domain` to the :any:`Strand` being built. This is an
"absolute move", whereas :py:meth:`StrandBuilder.move` is a "relative move".
This updates the underlying :any:`Design` with a new :any:`Domain`,
and if :py:meth:`StrandBuilder.loopout` was last called on this :any:`StrandBuilder`,
also a new :any:`Loopout`.
If two instances of :py:meth:`StrandBuilder.to` are chained together, this creates two domains
on the same helix. The two offsets must move in the same direction. In other words, if the starting
offset is ``s``, and we call ``.to(o1).to(o2)``, then either ``s < o1 < o2`` or ``o2 < o1 < s``
must be true.
To simply change the current offset after calling :py:meth:`StrandBuilder.to`, without creating
a new Domain, call :py:meth:`StrandBuilder.update_to` instead.
:param offset: new offset to extend to. If less than current offset,
the new :any:`Domain` is reverse, otherwise it is forward.
:return: self
"""
if self.last_domain and (
(self.last_domain.forward and offset < self.current_offset)
or (not self.last_domain.forward and offset > self.current_offset)
):
raise IllegalDesignError(
"offsets must be monotonic "
"(strictly increasing or strictly decreasing) "
"when calling to() twice in a row"
)
if self._most_recently_added_substrand_is_extension_3p():
raise IllegalDesignError("cannot make a new domain once 3' extension has been added")
if offset > self.current_offset:
forward = True
start = self.current_offset
end = offset
elif offset < self.current_offset:
forward = False
start = offset
end = self.current_offset
else:
raise IllegalDesignError(f"offset {offset} cannot be equal to current offset")
domain: Domain = Domain(helix=self.current_helix, forward=forward, start=start, end=end)
self.last_domain = domain
if self._strand is not None:
self.design.append_domain(self._strand, domain)
else:
self._strand = Strand(domains=[domain])
self.design.add_strand(self._strand)
self.design._check_strand_has_legal_offsets_in_helices(self._strand) # noqa
self.current_offset = offset
return self
def _most_recently_added_substrand_is_extension_3p(self) -> bool:
if self._strand is None:
return False
return len(self._strand.domains) > 1 and self._most_recently_added_substrand_is_extension()
[docs]
def update_to(self, offset: int) -> StrandBuilder:
"""
Like :meth:`StrandBuilder.to`, but changes the current offset without creating
a new :any:`Domain`. So unlike :meth:`StrandBuilder.to`, several consecutive calls to
:meth:`StrandBuilder.update_to` are equivalent to only making the final call.
Generally there's no point in calling :meth:`StrandBuilder.update_to` in one line of code.
It is intended to help when a large, complex strand is being constructed in a loop.
If :meth:`StrandBuilder.cross` or :meth:`StrandBuilder.loopout` was just called,
then :meth:`StrandBuilder.to` and :meth:`StrandBuilder.update_to` have the same effect.
:param offset: new offset to extend to. If less than offset of the last call to
:meth:`StrandBuilder.cross` or :py:meth:`StrandBuilder.loopout`,
the new :any:`Domain` is reverse, otherwise it is forward.
:return: self
"""
if self._most_recently_added_substrand_is_extension_3p():
raise IllegalDesignError("Cannot call update_to after creating extension_3p.")
if not self.last_domain:
return self.to(offset)
domain = self.last_domain
if (self.last_domain.forward and offset < self.current_offset) or (
not self.last_domain.forward and offset > self.current_offset
):
raise IllegalDesignError("when calling ")
if domain.forward:
domain.set_end(offset)
else:
domain.set_start(offset)
self.current_offset = offset
return self
[docs]
def as_circular(self) -> StrandBuilder:
"""
Makes :any:`Strand` being built circular.
:return: self
"""
if self._strand is None:
raise ValueError("no Strand created yet; make at least one domain first")
self._strand.set_circular()
return self
[docs]
def as_scaffold(self) -> StrandBuilder:
"""
Makes :any:`Strand` being built a scaffold.
:return: self
"""
if self._strand is None:
raise ValueError("no Strand created yet; make at least one domain first")
self._strand.set_scaffold(True)
return self
[docs]
def with_vendor_fields(
self,
scale: str = default_vendor_scale,
purification: str = default_vendor_purification,
plate: str | None = None,
well: str | None = None,
) -> StrandBuilder:
"""
Gives :any:`VendorFields` value to :any:`Strand` being built.
:param scale:
see :py:data:`VendorFields.scale`
:param purification:
see :py:data:`VendorFields.purification`
:param plate:
see :py:data:`VendorFields.plate`
:param well:
see :py:data:`VendorFields.well`
:return: self
"""
if self._strand is None:
raise ValueError("no Strand created yet; make at least one domain first")
self._strand.vendor_fields = VendorFields(scale=scale, purification=purification, plate=plate, well=well)
return self
[docs]
def with_modification_5p(self, mod: Modification5Prime) -> StrandBuilder:
"""
Sets Strand being built to have given 5' modification.
:param mod: 5' modification
:return: self
"""
if self._strand is None:
raise ValueError("no Strand created yet; make at least one domain first")
self._strand.set_modification_5p(mod)
return self
[docs]
def with_modification_3p(self, mod: Modification3Prime) -> StrandBuilder:
"""
Sets Strand being built to have given 3' modification.
:param mod: 3' modification
:return: self
"""
if self._strand is None:
raise ValueError("no Strand created yet; make at least one domain first")
self._strand.set_modification_3p(mod)
return self
[docs]
def with_modification_internal(
self, idx: int, mod: ModificationInternal, warn_no_dna: bool = True
) -> StrandBuilder:
"""
Sets Strand being built to have given internal modification.
:param idx: idx along DNA sequence of internal modification
:param mod: internal modification
:param warn_no_dna: whether to print warning to screen if DNA has not been assigned
:return: self
"""
if self._strand is None:
raise ValueError("no Strand created yet; make at least one domain first")
self._strand.set_modification_internal(idx, mod, warn_no_dna)
return self
[docs]
def with_color(self, color: Color) -> StrandBuilder:
"""
Sets Strand being built to have given color.
:param color: color to set for Strand
:return: self
"""
if self._strand is None:
raise ValueError("no Strand created yet; make at least one domain first")
self._strand.set_color(color)
return self
[docs]
def with_sequence(self, sequence: str, assign_complement: bool = False) -> StrandBuilder:
"""
Assigns `sequence` as DNA sequence of the :any:`Strand` being built.
This should be done after the :any:`Strand`'s structure is done being built, e.g.,
.. code-block:: Python
design.draw_strand(0, 0).to(10).cross(1).to(5).with_sequence('AAAAAAAAAACGCGC')
:param sequence: the DNA sequence to assign to the :any:`Strand`
:param assign_complement: whether to automatically assign the complement to existing :any:`Strand`'s
bound to this :any:`Strand`. This has the same meaning as the parameter `assign_complement` in
:py:meth:`Design.assign_dna`.
:return: self
"""
if self._strand is None:
raise ValueError("no Strand created yet; make at least one domain first")
self.design.assign_dna(strand=self._strand, sequence=sequence, assign_complement=assign_complement)
return self
[docs]
def with_domain_sequence(self, sequence: str, assign_complement: bool = False) -> StrandBuilder:
"""
Assigns `sequence` as DNA sequence of the most recently created :any:`Domain` in
the :any:`Strand` being built. This should be called immediately after a :any:`Domain` is created
via a call to
:py:meth:`StrandBuilder.to`,
:py:meth:`StrandBuilder.update_to`,
:py:meth:`StrandBuilder.move`,
:py:meth:`StrandBuilder.extension_5p`,
:py:meth:`StrandBuilder.extension_3p`,
or
:py:meth:`StrandBuilder.loopout`, e.g.,
.. code-block:: Python
design.draw_strand(0, 5)\\
.extension_5p(2).with_domain_sequence('TT')\\
.to(8).with_domain_sequence('AAA')\\
.cross(1).move(-3).with_domain_sequence('TTT')\\
.loopout(2, 4).with_domain_sequence('CCCC')\\
.to(10).with_domain_sequence('GGGGG')\\
.extension_3p(4).with_domain_sequence('AAAA')
:param sequence: the DNA sequence to assign to the :any:`Domain`
:param assign_complement: whether to automatically assign the complement to existing :any:`Strand`'s
bound to this :any:`Strand`. This has the same meaning as the parameter `assign_complement` in
:py:meth:`Design.assign_dna`.
:return: self
"""
if self._strand is None:
raise ValueError("no Strand created yet; make at least one domain first")
last_domain = self._strand.domains[-1]
self.design.assign_dna(
strand=self._strand, sequence=sequence, domain=last_domain, assign_complement=assign_complement
)
return self
[docs]
def with_domain_color(self, color: Color) -> StrandBuilder:
"""
Sets most recent :any:`Domain`/:any:`Loopout`/:any:`Extension`
to have given color.
:param color:
color to set for :any:`Domain`/:any:`Loopout`/:any:`Extension`
:return:
self
"""
if self._strand is None:
raise ValueError("no Strand created yet; make at least one domain first")
last_domain = self._strand.domains[-1]
last_domain.color = color
return self
[docs]
def with_name(self, name: str) -> StrandBuilder:
"""
Assigns `name` as name of the :any:`Strand` being built.
.. code-block:: Python
design.draw_strand(0, 0).to(10).cross(1).to(5).with_name('scaffold')
:param name: name to assign to the :any:`Strand`
:return: self
"""
if self._strand is None:
raise ValueError("no Strand created yet; make at least one domain first")
self._strand.set_name(name)
return self
[docs]
def with_label(self, label: str) -> StrandBuilder:
"""
Assigns `label` as label of the :any:`Strand` being built.
.. code-block:: Python
design.draw_strand(0, 0).to(10).cross(1).to(5).with_label('scaffold')
:param label: label to assign to the :any:`Strand`
:return: self
"""
if self._strand is None:
raise AssertionError("_strand cannot be None")
self._strand.set_label(label)
return self
[docs]
def with_domain_name(self, name: str) -> StrandBuilder:
"""
Assigns `name` as of the most recently created :any:`Domain` or :any:`Loopout` in
the :any:`Strand` being built. This should be called immediately after a :any:`Domain` is created
via a call to
:meth:`StrandBuilder.to`,
:meth:`StrandBuilder.move`,
:meth:`StrandBuilder.update_to`,
or
:meth:`StrandBuilder.loopout`, e.g.,
.. code-block:: Python
design.draw_strand(0, 0).to(10).with_domain_name('dom1*').cross(1).to(5).with_domain_name('dom1')
:param name: name to assign to the most recently created :any:`Domain` or :any:`Loopout`
:return: self
"""
if self._strand is None:
raise ValueError("no Strand created yet; make at least one domain first")
last_domain = self._strand.domains[-1]
last_domain.set_name(name)
return self
[docs]
def with_domain_label(self, label: str) -> StrandBuilder:
"""
Assigns `label` as label of the most recently created :any:`Domain` or :any:`Loopout` in
the :any:`Strand` being built. This should be called immediately after
a :any:`Domain` or :any:`Loopout` is created via a call to
:meth:`StrandBuilder.to`,
:meth:`StrandBuilder.move`,
:meth:`StrandBuilder.update_to`,
or
:meth:`StrandBuilder.loopout`, e.g.,
.. code-block:: Python
design.draw_strand(0, 5)\\
.to(8).with_domain_label('domain 1')\\
.cross(1)\\
.to(5).with_domain_label('domain 2')\\
.loopout(2, 4).with_domain_label('domain 3')\\
.to(10).with_domain_label('domain 4')
:param label: label to assign to the :any:`Domain` or :any:`Loopout`
:return: self
"""
if self._strand is None:
raise ValueError("no Strand created yet; make at least one domain first")
last_domain = self._strand.domains[-1]
last_domain.set_label(label)
return self
[docs]
def with_deletions(self, deletions: int | Iterable[int]) -> StrandBuilder:
"""
Assigns `deletions` as the deletion(s) of the most recently created
:any:`Domain` the :any:`Strand` being built. This should be called immediately after
a :any:`Domain` is created via a call to
:meth:`StrandBuilder.to`,
:meth:`StrandBuilder.move`,
:meth:`StrandBuilder.update_to`, e.g.,
.. code-block:: Python
design.draw_strand(0, 0)\\
.move(8).with_deletions(4)\\
.cross(1)\\
.move(-8).with_deletions([2, 3])
:param deletions:
a single int, or an Iterable of ints, indicating the offset at which to put the deletion(s)
:return: self
"""
if self._strand is None:
raise ValueError("no Strand created yet; make at least one domain first")
last_domain = self._strand.domains[-1]
if not isinstance(last_domain, Domain):
raise ValueError(
f"can only create a deletion on a bound Domain, not a {type(last_domain)};\n"
f"be sure only to call with_deletions immediately after a call to "
f"to, move, or update_to"
)
if not isinstance(deletions, int) and not hasattr(deletions, "__iter__"):
raise ValueError(f"deletions must be a single int or an iterable of ints, but it is {type(deletions)}")
if isinstance(deletions, int):
last_domain.deletions = [deletions]
else:
last_domain.deletions = list(deletions)
for deletion in last_domain.deletions:
if not last_domain.start <= deletion < last_domain.end:
raise IllegalDesignError(
f"all deletions must be between start={last_domain.start} "
f"and end={last_domain.end}, but deletion={deletion} is outside "
f"that range"
)
return self
[docs]
def with_insertions(self, insertions: tuple[int, int] | Iterable[tuple[int, int]]) -> StrandBuilder:
"""
Assigns `insertions` as the insertion(s) of the most recently created
:any:`Domain` the :any:`Strand` being built. This should be called immediately after
a :any:`Domain` is created via a call to
:meth:`StrandBuilder.to`,
:meth:`StrandBuilder.move`,
:meth:`StrandBuilder.update_to`, e.g.,
.. code-block:: Python
design.draw_strand(0, 0)\\
.move(8).with_insertions((4, 2))\\
.cross(1)\\
.move(-8).with_insertions([(2, 3), (3, 3)])
:param insertions:
a single pair of ints (tuple), or an Iterable of pairs of ints (tuples)
indicating the offset at which to put the insertion(s)
:return: self
"""
if self._strand is None:
raise ValueError("no Strand created yet; make at least one domain first")
last_domain = self._strand.domains[-1]
if not isinstance(last_domain, Domain):
raise ValueError(
f"can only create an insertion on a bound Domain, not a {type(last_domain)};\n"
f"be sure only to call with_insertions immediately after a call to "
f"to, move, or update_to"
)
type_msg = (
f"insertions must be a single pair of ints or an iterable of pairs of ints, but it is {type(insertions)}"
)
if not hasattr(insertions, "__iter__"):
raise ValueError(type_msg)
if isinstance(insertions, tuple) and len(insertions) > 0 and isinstance(insertions[0], int):
last_domain.insertions = [insertions] # type: ignore
else:
for ins in insertions:
if not (isinstance(ins, tuple) and len(ins) > 0 and isinstance(ins[0], int)):
raise ValueError(type_msg)
last_domain.insertions = list(insertions) # type: ignore
for insertion in last_domain.insertions:
insertion_offset, _ = insertion
if not last_domain.start <= insertion_offset < last_domain.end:
raise IllegalDesignError(
f"all insertions must be between start={last_domain.start} "
f"and end={last_domain.end}, but insertion={insertion} at offset "
f"{insertion_offset} is outside that range"
)
return self
[docs]
@dataclass
class Strand(_JSONSerializable):
"""
Represents a single strand of DNA.
Each maximal portion that is continguous on a single :any:`Helix` is a :any:`Domain`.
Crossovers from one :any:`Helix` to another are implicitly from the 3' end of one of this
Strand's :any:`Domain`'s to the 5' end of the next :any:`Domain`.
A portion of the :any:`Strand` not associated to any :any:`Helix` is represented either by a :any:`Loopout`
(if in between two :any:`Domain`'s) or an :any:`Extension` (if on the 5' or 3' end of the :any:`Strand`).
Two :any:`Loopout`'s cannot occur consecutively on a :any:`Strand`, nor can a :any:`Strand`
contain only a :any:`Loopout`, or only an :any:`Extension`, but no :any:`Domain`.
One can set the strand to be a scaffold in the constructor:
.. code-block:: Python
import scadnano as sc
scaffold_domains = [ ... ]
scaffold_strand = sc.Strand(domains=scaffold_domains, is_scaffold=True)
or by calling :meth:`Strand.set_scaffold` on the :any:`Strand` object:
.. code-block:: Python
import scadnano as sc
scaffold_domains = [ ... ]
scaffold_strand = sc.Strand(domains=scaffold_domains)
scaffold_strand.set_scaffold()
or by calling :meth:`StrandBuilder.as_scaffold` on the :any:`StrandBuilder` object returned by
:meth:`Design.strand`:
.. code-block:: Python
import scadnano as sc
design = sc.Design(helices=[sc.Helix(max_offset=100) for _ in range(2)])
scaffold_strand = design.strand(0, 0).move(100).cross(1).move(-100).as_scaffold()
By default, these will give the strand the same color that
`cadnano <https://cadnano.org>`_
uses for the scaffold.
"""
domains: list[Domain | Loopout | Extension]
""":any:`Domain`'s (or :any:`Loopout`'s or :any:`Extension`'s) composing this :any:`Strand`.
Each :any:`Domain` is contiguous on a single :any:`Helix`
and could be either single-stranded or double-stranded,
whereas each :any:`Loopout` and :any:`Extension` is single-stranded and has no associated :any:`Helix`."""
circular: bool = False
"""If True, this :any:`Strand` is circular and has no 5' or 3' end. Although there is still a
first and last :any:`Domain`, we interpret there to be a crossover from the 3' end of the last domain
to the 5' end of the first domain, and any circular permutation of :data:`Strand.domains`
should result in a functionally equivalent :any:`Strand`. It is illegal to have a
:any:`Modification5Prime` or :any:`Modification3Prime` on a circular :any:`Strand`."""
@property
def dna_sequence(self) -> str | None:
"""Do not assign directly to this field. Always use :any:`Design.assign_dna`
(for complementarity checking) or :any:`Strand.set_dna_sequence`
(without complementarity checking, to allow mismatches).
Note that this does not include any vendor codes for :any:`Modification`'s.
To include those call :meth:`Strand.vendor_dna_sequence`."""
sequence_list = []
for domain in self.domains:
if domain.dna_sequence is None:
return None
sequence_list.append(domain.dna_sequence)
return "".join(sequence_list)
color: Color | None = None
"""Color to show this strand in the main view. If not specified in the constructor,
a color is assigned by cycling through a list of defaults given by
:meth:`ColorCycler.colors`"""
vendor_fields: VendorFields | None = None
"""
Fields used when ordering strands from the a DNA synthesis company such as IDT
(Integrated DNA Technologies, Coralville, IA). If present (i.e., not equal to :const:`None`)
then the method :meth:`Design.write_idt_bulk_input_file` can be called to automatically
generate an text file for ordering strands in test tubes:
https://www.idtdna.com/site/order/oligoentry,
as can the method :py:meth:`Design.write_idt_plate_excel_file` for writing a Microsoft Excel
file that can be uploaded to IDT's website for describing DNA sequences to be ordered in 96-well
or 384-well plates:
https://www.idtdna.com/site/order/plate/index/dna/1800
Currently no other vendors are supported via export methods in the package,
but one could write custom export code based on these fields since most DNA synthesis companies
support the same concepts of scale, purification, and a code for modifications
(such as ``"/5Biosg/"`` for 5' biotin from IDT).
"""
is_scaffold: bool = False
"""Indicates whether this :any:`Strand` is a scaffold for a DNA origami. If any :any:`Strand` in a
:any:`Design` is a scaffold, then the design is considered a DNA origami design."""
modification_5p: Modification5Prime | None = None
"""
5' modification; None if there is no 5' modification.
Illegal to have if :py:data:`Strand.circular` is True.
"""
modification_3p: Modification3Prime | None = None
"""
3' modification; None if there is no 3' modification.
Illegal to have if :py:data:`Strand.circular` is True.
"""
modifications_int: dict[int, ModificationInternal] = field(default_factory=dict)
""":any:`Modification`'s to the DNA sequence (e.g., biotin, Cy3/Cy5 fluorphores).
Maps index within DNA sequence to modification. If the internal modification is attached to a base
(e.g., internal biotin, /iBiodT/ from IDT),
then the index is that of the base.
If it goes between two bases
(e.g., internal Cy3, /iCy3/ from IDT),
then the index is that of the previous base,
e.g., to put a Cy3 between bases at indices 3 and 4, the index should be 3.
So for an internal modified base on a sequence of length n, the allowed indices are 0,...,n-1,
and for an internal modification that goes between bases, the allowed indices are 0,...,n-2."""
name: str | None = None
"""
Optional name to give the strand. If specified it is shown on mouseover in the scadnano web interface.
This is used to interoperate with the dsd DNA sequence design package.
"""
label: str | None = None
"""
This can be used to attach a "label" to associate to this :any:`Strand`.
Useful for associating extra information with the :any:`Strand` that will be serialized, for example,
for DNA sequence design. It can be useful to create "groups" of strands related in some way.
Prior to version 0.18.0, this was allowed to be an arbitrary JSON-serializable object.
Now it is just a string
(see https://github.com/UC-Davis-molecular-computing/scadnano-python-package/issues/261).
To store more structured data, it is necessary to serialize (convert to a string) the data manually.
For example, if you want to store a list of numbers, you can do so as a string like this:
.. code-block:: python
import json
nums = [1, 2, 3]
strand.label = json.dumps(nums) # stores strand.label as the string '[1, 2, 3]'
# and to get the structured data back out:
nums = json.loads(strand.label) # nums is now the list [1, 2, 3]
"""
# not serialized; efficient way to see a list of all domains on a given helix on this strand
_helix_idx_domain_map: dict[int, list[Domain]] = field(init=False, repr=False, compare=False, default_factory=dict)
def __init__(
self,
domains: list[Domain | Loopout | Extension],
circular: bool = False,
color: Color | None = None,
vendor_fields: VendorFields | None = None,
is_scaffold: bool = False,
modification_5p: Modification5Prime | None = None,
modification_3p: Modification3Prime | None = None,
modifications_int: dict[int, ModificationInternal] | None = None,
name: str | None = None,
label: str | None = None,
_helix_idx_domain_map: dict[int, list[Domain]] | None = None,
dna_sequence: str | None = None,
):
self.domains = domains
self.circular = circular
self.color = color
self.vendor_fields = vendor_fields
self.is_scaffold = is_scaffold
self.modification_5p = modification_5p
self.modification_3p = modification_3p
self.modifications_int = modifications_int if modifications_int is not None else dict()
self.name = name
self.label = label
self._helix_idx_domain_map = _helix_idx_domain_map if _helix_idx_domain_map is not None else defaultdict(list)
if dna_sequence is not None:
self.set_dna_sequence(dna_sequence)
self.__post_init__()
def __post_init__(self) -> None:
self._ensure_domains_not_none()
self.set_domains(self.domains) # some error-checking code is in this method
self._ensure_modifications_legal()
self._ensure_domains_nonoverlapping()
def to_json_serializable(self, suppress_indent: bool = True, **kwargs: Any) -> dict[str, Any]:
dct: dict[str, Any] = OrderedDict()
if self.name is not None:
dct[strand_name_key] = self.name
if self.circular:
dct[circular_key] = self.circular
if self.color is not None:
dct[color_key] = self.color.to_json_serializable(suppress_indent)
if self.dna_sequence is not None:
dct[dna_sequence_key] = self.dna_sequence
if self.vendor_fields is not None:
dct[vendor_key] = self.vendor_fields.to_json_serializable(suppress_indent)
dct[domains_key] = [domain.to_json_serializable(suppress_indent) for domain in self.domains]
if hasattr(self, is_scaffold_key) and self.is_scaffold:
dct[is_scaffold_key] = self.is_scaffold
if self.modification_5p is not None:
dct[modification_5p_key] = self.modification_5p.vendor_code
if self.modification_3p is not None:
dct[modification_3p_key] = self.modification_3p.vendor_code
if len(self.modifications_int) > 0:
mods_dict = {}
for offset, mod in self.modifications_int.items():
mods_dict[f"{offset}"] = mod.vendor_code
dct[modifications_int_key] = NoIndent(mods_dict) if suppress_indent else mods_dict
if self.label is not None:
dct[strand_label_key] = self.label
return dct
@staticmethod
def from_json(json_map: dict) -> Strand:
substrand_jsons = mandatory_field(Strand, json_map, domains_key, legacy_keys=legacy_domains_keys)
if len(substrand_jsons) == 0:
raise IllegalDesignError(f"{domains_key} list cannot be empty")
substrands: list[Domain | Loopout | Extension] = []
for substrand_json in substrand_jsons:
if loopout_key in substrand_json:
substrands.append(Loopout.from_json(substrand_json))
elif extension_key in substrand_json:
substrands.append(Extension.from_json(substrand_json))
elif helix_idx_key in substrand_json:
substrands.append(Domain.from_json(substrand_json))
else:
raise IllegalDesignError(
"unrecognized substrand; does not have any of these keys:\n"
f"{extension_key} for an Extension, "
f"{loopout_key} for a Loopout, or"
f"{helix_idx_key} for a Domain.\n"
f"JSON: {substrand_json}"
)
if isinstance(substrands[0], Loopout):
raise IllegalDesignError("Loopout at beginning of Strand not supported")
if isinstance(substrands[-1], Loopout):
raise IllegalDesignError("Loopout at end of Strand not supported")
is_scaffold = json_map.get(is_scaffold_key, False)
circular = json_map.get(circular_key, False)
dna_sequence = optional_field(None, json_map, dna_sequence_key, legacy_keys=legacy_dna_sequence_keys)
color_json = json_map.get(color_key)
if color_json is None:
color = default_scaffold_color if is_scaffold else default_strand_color
else:
color = Color.from_json(color_json)
label = json_map.get(strand_label_key)
name = json_map.get(strand_name_key)
vendor_dict: dict | None = optional_field(None, json_map, vendor_key, legacy_keys=legacy_vendor_keys)
vendor_fields = None if vendor_dict is None else VendorFields.from_json(vendor_dict)
# legacy:
# if no name is specified, but there's a name field in vendor fields,
# then use that as the Strand's name
if name is None and vendor_dict is not None and vendor_name_key in vendor_dict:
name = vendor_dict[vendor_name_key]
return Strand(
domains=substrands,
dna_sequence=dna_sequence,
circular=circular,
color=color,
vendor_fields=vendor_fields,
is_scaffold=is_scaffold,
name=name,
label=label,
)
def __eq__(self, other: Any) -> bool:
if not isinstance(other, Strand):
return False
return self.domains == other.domains
def __hash__(self) -> int:
return hash(self.domains)
def __str__(self) -> str:
return repr(self) if self.name is None else self.name
[docs]
def rotate_domains(self, rotation: int, forward: bool = True) -> None:
"""
"Rotates" the strand by replacing domains with a circular rotation, e.g., if the domains are
A, B, C, D, E, F
then ``strand.rotate_domains(2)`` makes the :any:`Strand` have the same domains, but in this order:
E, F, A, B, C, D
and ``strand.rotate_domains(2, forward=False)`` makes
C, D, E, F, A, B
:param rotation:
Amount to rotate domains.
:param forward:
Whether to move domains forward (wrapping off 3' end back to 5' end) or backward (wrapping off
5' end back to 3' end).
"""
idx = rotation if not forward else len(self.domains) - rotation
self.domains = self.domains[idx:] + self.domains[:idx]
[docs]
def set_scaffold(self, is_scaf: bool = True) -> None:
"""Sets this :any:`Strand` as a scaffold. Alters color to default scaffold color.
If `is_scaf` == ``False``, sets this strand as not a scaffold, and leaves the color alone."""
self.is_scaffold = is_scaf
if is_scaf:
self.color = default_scaffold_color
[docs]
def set_name(self, name: str) -> None:
"""Sets name of this :any:`Strand`."""
self.name = name
[docs]
def set_label(self, label: Any) -> None:
"""Sets label of this :any:`Strand`."""
self.label = label
[docs]
def set_color(self, color: Color) -> None:
"""Sets color of this :any:`Strand`."""
self.color = color
[docs]
def set_circular(self, circular: bool = True) -> None:
"""
Sets this to be a circular :any:`Strand` (or non-circular if optional parameter is False).
:param circular:
whether to make this :any:`Strand` circular (True) or linear (False)
:raises StrandError:
if this :any:`Strand` has a 5' or 3' modification
"""
if circular and self.modification_5p is not None:
raise StrandError(self, "cannot have a 5' modification on a circular strand")
if circular and self.modification_3p is not None:
raise StrandError(self, "cannot have a 3' modification on a circular strand")
if circular and self.contains_extensions():
raise StrandError(self, "Cannot have extension on a circular strand")
self.circular = circular
[docs]
def set_linear(self) -> None:
"""
Makes this a linear (non-circular) :any:`Strand`. Equivalent to calling
`self.set_circular(False)`.
"""
self.set_circular(False)
[docs]
def set_domains(self, domains: Iterable[Domain | Loopout | Extension]) -> None:
"""
Sets the :any:`Domain`'s/:any:`Loopout`'s/:any:`Extension`'s of this :any:`Strand` to be `domains`,
which can contain a mix of :any:`Domain`'s, :any:`Loopout`'s, and :any:`Extension`'s,
just like the field :py:data:`Strand.domains`.
:param domains:
The new sequence of :any:`Domain`'s/:any:`Loopout`'s/:any:`Extension`'s to use for this
:any:`Strand`.
:raises StrandError:
if domains has two consecutive :any:`Loopout`'s, consists of just a single :any:`Loopout`'s
or a single :any:`Extension`, or starts or ends with a :any:`Loopout`,
or has an :any:`Extension` on a circular :any:`Strand`,
or has an :any:`Extension` not as the first or last element of `domains`.
"""
self.domains = domains if isinstance(domains, list) else list(domains)
for domain in self.domains:
if isinstance(domain, Domain):
self._helix_idx_domain_map[domain.helix].append(domain)
for domain in self.domains:
domain._parent_strand = self
if len(self.domains) == 1:
if isinstance(self.domains[0], Loopout):
raise StrandError(self, "strand cannot have a single Loopout as its only domain")
if len(self.domains) == 0:
raise StrandError(self, "domains cannot be empty")
for domain in self.domains[1:-1]:
if isinstance(domain, Extension):
raise StrandError(self, "cannot have an Extension in the middle of domains")
for domain1, domain2 in _pairwise(self.domains):
if isinstance(domain1, Loopout) and isinstance(domain2, Loopout):
raise StrandError(self, "cannot have two consecutive Loopouts in a strand")
if isinstance(self.domains[0], Loopout):
raise StrandError(self, "strand cannot begin with a loopout")
if isinstance(self.domains[-1], Loopout):
raise StrandError(self, "strand cannot end with a loopout")
[docs]
def vendor_export_name(self, unique_names: bool = False) -> str:
"""
:param unique_names:
If True and default name is used,
enforces that strand names must be unique by encoding the forward/reverse Boolean
into the name.
If False (the default), uses cadnano's exact naming convention, which allows two strands
to have the same default name, if they begin and end at the same (helix,offset) pair (but
point in opposite directions at each).
Has no effect if :data:`Strand.vendor_fields` or :py:data:`Strand.name` are defined;
if those are used, they must be explicitly set to be unique.
:return:
If :py:data:`Strand.name` is not None, return :py:data:`Strand.name`,
otherwise return the result of :py:meth:`Strand.default_export_name`
with parameter `unique_names`.
"""
return self.name if self.name is not None else self.default_export_name(unique_names)
[docs]
def default_export_name(self, unique_names: bool = False) -> str:
"""
Returns a default name to use when exporting the DNA sequence.
Uses cadnano's naming
convention of, for example `'ST2[5]4[10]'` to indicate a strand that starts at helix 2, offset 5,
and ends at helix 4, offset 10. Note that this naming convention is not unique: two strands in
the system could share this name. To ensure it is unique, set the parameter `unique_names` to True,
which will modify the name with forward/reverse information from the first domain that uniquely
identifies the strand, e.g., `'ST2[5]F4[10]'` or `'ST2[5]R4[10]'`.
If the strand is a scaffold (i.e., if :py:data:`Strand.is_scaffold` is True),
then the name will begin with `'SCAF'` instead of `'ST'`.
:param unique_names:
If True, enforces that strand names must be unique by encoding the forward/reverse Boolean
into the name.
If False (the default), uses cadnano's exact naming convention, which allows two strands
to have the same default name, if they begin and end at the same (helix,offset) pair (but
point in opposite directions at each).
:return:
default name to export
(used, for example, by idt DNA export methods :py:meth:`Design.write_idt_plate_excel_file`
and :py:meth:`Design.write_idt_bulk_input_file`
if :py:data:`Strand.name` and :data:`Strand.vendor_fields.name` are both not set)
"""
start_helix = self.first_bound_domain().helix
end_helix = self.last_bound_domain().helix
start_offset = self.first_bound_domain().offset_5p()
end_offset = self.last_bound_domain().offset_3p()
forward_str = "F" if self.first_bound_domain().forward else "R"
if not unique_names:
forward_str = ""
name = f"{start_helix}[{start_offset}]{forward_str}{end_helix}[{end_offset}]"
return f"SCAF{name}" if self.is_scaffold else f"ST{name}"
def has_multiple_bound_domains(self) -> bool:
num_bound_domains = 0
for domain in self.domains:
if isinstance(domain, Domain):
num_bound_domains += 1
return num_bound_domains > 1
[docs]
def set_modification_5p(self, mod: Modification5Prime) -> None:
"""Sets 5' modification to be `mod`. :any:`Strand.circular` must be False."""
if self.circular:
raise StrandError(self, "cannot have a 5' modification on a circular strand")
if not isinstance(mod, Modification5Prime):
raise TypeError(f"mod must be a Modification5Prime but it is type {type(mod)}: {mod}")
self.modification_5p = mod
[docs]
def set_modification_3p(self, mod: Modification3Prime) -> None:
"""Sets 3' modification to be `mod`. :any:`Strand.circular` must be False."""
if self.circular and mod is not None:
raise StrandError(self, "cannot have a 3' modification on a circular strand")
if not isinstance(mod, Modification3Prime):
raise TypeError(f"mod must be a Modification3Prime but it is type {type(mod)}: {mod}")
self.modification_3p = mod
[docs]
def remove_modification_5p(self) -> None:
"""Removes 5' modification."""
self.modification_5p = None
[docs]
def remove_modification_3p(self) -> None:
"""Removes 3' modification."""
self.modification_3p = None
[docs]
def set_modification_internal(self, idx: int, mod: ModificationInternal, warn_on_no_dna: bool = True) -> None:
"""Adds internal modification `mod` at given DNA index `idx`."""
if idx < 0:
raise IllegalDesignError("idx of modification must be nonnegative")
if idx >= self.dna_length():
raise IllegalDesignError(f"idx of modification must be at most length of DNA: {self.dna_length()}")
if self.dna_sequence is not None:
if mod.allowed_bases is not None and self.dna_sequence[idx] not in mod.allowed_bases:
raise IllegalDesignError(
f"only bases {','.join(mod.allowed_bases)} are allowed at "
f"index {idx}, but sequence has base {self.dna_sequence[idx]} "
f"\nDNA sequence: {self.dna_sequence}"
f"\nmodification: {mod}"
)
elif warn_on_no_dna:
print(
"WARNING: no DNA sequence has been assigned, so certain error checks on the internal "
"modification were not done. To be safe, first assign DNA, then add the modifications."
)
if not isinstance(mod, ModificationInternal):
raise TypeError(f"mod must be a ModificationInternal but it is type {type(mod)}: {mod}")
self.modifications_int[idx] = mod
[docs]
def remove_modification_internal(self, idx: int) -> None:
"""Removes internal modification at given DNA index `idx`."""
if idx in self.modifications_int:
del self.modifications_int[idx]
[docs]
def first_domain(self) -> Domain:
"""First domain on this :any:`Strand`."""
for domain in self.domains:
if isinstance(domain, Domain):
return domain
raise StrandError(self, "strand has no domains")
[docs]
def last_domain(self) -> Domain:
"""Last domain on this :any:`Strand`."""
for domain in reversed(self.domains):
if isinstance(domain, Domain):
return domain
raise StrandError(self, "strand has no domains")
[docs]
def dna_sequence_delimited(self, delimiter: str) -> str:
"""
:param delimiter:
string to put in between DNA sequences of each domain
:return:
DNA sequence of this :any:`Strand`, with `delimiter` in between DNA sequences of each
:any:`Domain` or :any:`Loopout`.
"""
for domain in self.domains:
if domain.dna_sequence is None:
raise StrandError(
self, "cannot get DNA sequence of strand because at least one domain has no DNA sequence assigned"
)
result = [substrand.dna_sequence for substrand in self.domains]
return delimiter.join(result) # type: ignore
[docs]
def set_dna_sequence(self, sequence: str) -> None:
"""Set this :any:`Strand`'s DNA sequence to `seq`
WITHOUT checking for complementarity with overlapping
:any:`Strand`'s or automatically assigning their sequences.
To assign a sequence to a :any:`Strand` and have the overlapping
:any:`Strand`'s automatically have the appropriate Watson-Crick complements assigned,
use :any:`Design.assign_dna`.
All whitespace in `sequence` is removed,
and lowercase bases 'a', 'c', 'g', 't' are converted to uppercase.
`sequence`, after all whitespace is removed, must be exactly the same length as
:py:meth:`Strand.dna_length`.
Wildcard symbols (:py:const:`DNA_base_wildcard`) are allowed to leave part of the DNA unassigned.
"""
trimmed_seq = _remove_whitespace_and_uppercase(sequence)
if len(trimmed_seq) != self.dna_length():
domain = self.first_domain()
strand_name = f' "{self.name}"' if self.name is not None else ""
raise StrandError(
self,
f"\nstrand{strand_name} starting at helix {domain.helix} offset {domain.offset_5p()} "
f"has length {self.dna_length()},\nbut you attempted to assign a "
f"DNA sequence of length {len(trimmed_seq)}:\n{sequence}",
)
start_idx_ss = 0
for d in self.domains:
end_idx_ss = start_idx_ss + d.dna_length()
dna_subseq = sequence[start_idx_ss:end_idx_ss]
d.dna_sequence = dna_subseq
start_idx_ss = end_idx_ss
[docs]
def dna_length(self) -> int:
"""
:return: sum of DNA length of :any:`Domain`'s, :any:`Loopout`'s, and :any:`Extension`'s of this :any:`Strand`.
"""
acc = 0
for domain in self.domains:
acc += domain.dna_length()
return acc
[docs]
def bound_domains(self) -> list[Domain]:
""":any:`Domain`'s of this :any:`Strand` that are not :any:`Loopout`'s or :any:`Extension`'s."""
return [domain for domain in self.domains if isinstance(domain, Domain)]
[docs]
def offset_5p(self) -> int:
"""5' offset of this entire :any:`Strand`, INCLUSIVE."""
return self.first_domain().offset_5p()
[docs]
def offset_3p(self) -> int:
"""3' offset of this entire :any:`Strand`, INCLUSIVE."""
return self.last_domain().offset_3p()
[docs]
def overlaps(self, other: Strand) -> bool:
"""Indicates whether `self` overlaps `other_strand`, meaning that the set of offsets occupied
by `self` has nonempty intersection with those occupied by `other_strand`."""
for domain_self in self.bound_domains():
for domain_other in other.bound_domains():
if domain_self.overlaps(domain_other):
return True
return False
[docs]
def assign_dna_complement_from(self, other: Strand) -> None:
"""Assuming a DNA sequence has been assigned to `other`, assign its Watson-Crick
complement to the portions of this Strand that are bound to `other`.
Generally this is not called directly; use :py:meth:`Design.assign_dna` to assign
a DNA sequence to a :any:`Strand`. The method :py:meth:`Design.assign_dna` will calculate
which other :any:`Strand`'s need
to be assigned via :py:meth:`Strand.assign_dna_complement_from`.
However, it is permitted to assign the field :py:data:`Strand.dna_sequence` directly
via the method :py:meth:`Strand.set_dna_sequence`.
This is used, for instance, to assign a DNA sequence to a :any:`Strand` bound to another
:any:`Strand`
with an assigned DNA sequence where they overlap. In this case no error checking
about sequence complementarity is done. This can be used to intentionally assign *mismatching*
DNA sequences to :any:`Strand`'s that are bound on a :any:`Helix`."""
already_assigned = self.dna_sequence is not None
# put DNA sequences to assign to domains in list, one position per domain
strand_complement_builder: list[str] = []
if already_assigned:
for domain in self.domains:
domain_seq = domain.dna_sequence
if domain_seq is None:
raise ValueError(f"no DNA sequence has been assigned to {self}")
strand_complement_builder.append(domain_seq)
else:
for domain in self.domains:
wildcards = DNA_base_wildcard * domain.dna_length()
strand_complement_builder.append(wildcards)
for domain_idx, domain_self in enumerate(self.domains):
if isinstance(domain_self, (Loopout, Extension)):
domain_self_dna_sequence = DNA_base_wildcard * domain_self.dna_length()
else:
helix = domain_self.helix
# for helix, domains_on_helix_self in self._helix_idx_domain_map.items():
domains_on_helix_other = other._helix_idx_domain_map[helix]
# for domain_self in domains_on_helix_self:
overlaps = []
for domain_other in domains_on_helix_other:
if domain_self != domain_other and domain_self.overlaps(domain_other):
overlap = domain_self.compute_overlap(domain_other)
overlaps.append((overlap, domain_other))
overlaps.sort()
domain_complement_builder = []
start_idx = domain_self.start
# repeatedly insert wildcards into gaps, then reverse complement
for (overlap_left, overlap_right), domain_other in overlaps:
# wildcards = DNA_base_wildcard * (overlap_left - start_idx)
num_wildcard_bases = domain_self.dna_length_in(start_idx, overlap_left - 1)
wildcards = DNA_base_wildcard * num_wildcard_bases
other_seq = domain_other.dna_sequence_in(overlap_left, overlap_right - 1)
if other_seq is None:
raise ValueError(f"no DNA sequence has been assigned to strand {other}")
overlap_complement = rc(other_seq)
domain_complement_builder.append(wildcards)
domain_complement_builder.append(overlap_complement)
start_idx = overlap_right
# last wildcard for gap between last overlap and end
# last_wildcards = DNA_base_wildcard * (domain_self.end - start_idx)
num_wildcard_bases = domain_self.dna_length_in(start_idx, domain_self.end - 1)
last_wildcards = DNA_base_wildcard * num_wildcard_bases
domain_complement_builder.append(last_wildcards)
# If pointing left, each individual overlap sequence was reverse orientation in rc(),
# but not the list of all of them put together until now.
if not domain_self.forward:
domain_complement_builder.reverse()
domain_self_dna_sequence = "".join(domain_complement_builder)
# merge with existing pre-assigned sequence
existing_domain_self_dna_sequence = strand_complement_builder[domain_idx]
merged_domain_self_dna_sequence = _string_merge_wildcard(
domain_self_dna_sequence, existing_domain_self_dna_sequence, DNA_base_wildcard
)
strand_complement_builder[domain_idx] = merged_domain_self_dna_sequence
strand_complement = "".join(strand_complement_builder)
new_dna_sequence = strand_complement
if self.dna_sequence is not None:
try:
new_dna_sequence = _string_merge_wildcard(self.dna_sequence, new_dna_sequence, DNA_base_wildcard)
except ValueError:
domain_self = self.first_domain()
domain_other = other.first_domain()
msg = (
f"strand starting at helix {domain_self.helix}, offset {domain_self.offset_5p()} "
f"has length "
f"{self.dna_length()} and already has a partial DNA sequence assignment of length "
f"{len(self.dna_sequence)}, which is \n"
f"{self.dna_sequence}, "
f"but you tried to assign sequence of length {len(new_dna_sequence)} to it, which "
f"is\n{new_dna_sequence} (this assignment was indirect, since you assigned directly "
f"to a strand bound to this one). This occurred while directly assigning a DNA "
f"sequence to the strand whose 5' end is at helix {domain_other.helix}, and is of "
f"length {other.dna_length()}."
)
raise IllegalDesignError(msg)
self.set_dna_sequence(new_dna_sequence)
# self.dna_sequence = _pad_dna(new_dna_sequence, self.dna_length())
def insert_domain(self, order: int, domain: Domain | Loopout | Extension) -> None:
# add wildcard symbols to DNA sequence to maintain its length
if self.dna_sequence is not None:
domain.dna_sequence = DNA_base_wildcard * domain.dna_length()
# Only intended to be called by Design.insert_domain
self.domains.insert(order, domain)
domain._parent_strand = self
if isinstance(domain, Domain):
self._helix_idx_domain_map[domain.helix].append(domain)
def remove_domain(self, domain: Domain | Loopout | Extension) -> None:
# Only intended to be called by Design.remove_domain
self.domains.remove(domain)
domain._parent_strand = None
if isinstance(domain, Domain):
self._helix_idx_domain_map[domain.helix].remove(domain)
[docs]
def dna_index_start_domain(self, domain: Domain | Loopout | Extension) -> int:
"""
Returns index in DNA sequence of domain, e.g., if there are five domains
.. code-block:: none
012 3 45 678 9
AAA-C-GG-TTT-ACGT
Then their indices, respectively in order, are 0, 3, 4, 6, 9.
:param domain: :any: to find the start DNA index of
:return: index (within DNA sequence string) of substring of DNA starting with given :any:`Domain`
"""
domain_order = self.domains.index(domain)
idx = sum(self.domains[i].dna_length() for i in range(domain_order))
return idx
def contains_loopouts(self) -> bool:
for domain in self.domains:
if isinstance(domain, Loopout):
return True
return False
def contains_extensions(self) -> bool:
assert len(self.domains) > 0
return isinstance(self.domains[0], Extension) or isinstance(self.domains[-1], Extension)
[docs]
def first_bound_domain(self) -> Domain:
"""First :any:`Domain` (i.e., not a :any:`Loopout`) on this :any:`Strand`.
Currently the first and last strand must not be :any:`Loopout`'s, so this should return the same
domain as :py:meth:`Strand.first_domain`, but in case an initial or final :any:`Loopout` is
supported in the future, this method is provided."""
for domain in self.domains:
if isinstance(domain, Domain):
return domain
raise StrandError(self, "should not be able to have a Strand with no (bound) Domains")
[docs]
def last_bound_domain(self) -> Domain:
"""Last :any:`Domain` (i.e., not a :any:`Loopout`) on this :any:`Strand`.
Currently the first and last strand must not be :any:`Loopout`'s, so this should return the same
domain as :py:meth:`Strand.first_domain`, but in case an initial or final :any:`Loopout` is
supported in the future, this method is provided."""
domain_rev = list(self.domains)
domain_rev.reverse()
for domain in domain_rev:
if isinstance(domain, Domain):
return domain
raise AssertionError("should not be able to have a Strand with no (bound) Domains")
[docs]
def reverse(self) -> None:
"""
Reverses "polarity" of this :any:`Strand`.
Does NOT check whether this keeps the :any:`Design` legal, so be cautious in calling this method
directly. To reverse every :any:`Strand`, called :py:meth:`Design.reverse_all`.
If the design was legal before, it will be legal after calling that method.
"""
self.domains.reverse()
for domain in self.bound_domains():
domain.forward = not domain.forward
def _ensure_domains_not_none(self) -> None:
if self.domains is None:
raise IllegalDesignError("parameter domains cannot be None")
for idx, domain in enumerate(self.domains):
if domain is None:
raise IllegalDesignError(
f"no element of parameter domains can be None, but the {idx}'th "
f"element is None. Here is the list of domains you specified:\n"
f"{self.domains}"
)
def _ensure_modifications_legal(self, check_offsets_legal: bool = False) -> None:
if check_offsets_legal:
if self.dna_sequence is None:
raise IllegalDesignError("must assign DNA sequence first")
mod_i_offsets_list = list(self.modifications_int.keys())
min_offset = min(mod_i_offsets_list) if len(mod_i_offsets_list) > 0 else None
max_offset = max(mod_i_offsets_list) if len(mod_i_offsets_list) > 0 else None
if min_offset is not None and min_offset < 0:
raise IllegalDesignError(
f"smallest offset is {min_offset} but must be nonnegative: {self.modifications_int}"
)
if max_offset is not None and max_offset > len(self.dna_sequence):
raise IllegalDesignError(
f"largest offset is {max_offset} but must be at most "
f"{len(self.dna_sequence)}: "
f"{self.modifications_int}"
)
def _ensure_domains_nonoverlapping(self) -> None:
for d1, d2 in itertools.combinations(self.domains, 2):
if isinstance(d1, Domain) and isinstance(d2, Domain) and d1.overlaps_illegally(d2):
raise StrandError(self, f"two domains on strand overlap:\n{d1}\n{d2}")
[docs]
def vendor_dna_sequence(self, domain_delimiter: str = "") -> str:
"""
:param domain_delimiter:
string to put in between DNA sequences of each domain, and between 5'/3' modifications and DNA.
Note that the delimiter is not put between internal modifications and the next base(s)
in the same domain.
:return: DNA sequence as it needs to be typed to order from a DNA synthesis vendor, with
:py:data:`Modification5Prime`'s,
:py:data:`Modification3Prime`'s,
and
:py:data:`ModificationInternal`'s represented with text codes, e.g., for IDT DNA, using
"/5Biosg/ACGT" for sequence ACGT with a 5' biotin modification.
"""
self._ensure_modifications_legal(check_offsets_legal=True)
if self.dna_sequence is None:
raise ValueError("DNA sequence has not been assigned yet")
ret_list: list[str] = []
if self.modification_5p is not None and self.modification_5p.vendor_code is not None:
ret_list.append(self.modification_5p.vendor_code)
for substrand in self.domains:
seq = substrand.vendor_dna_sequence()
if seq is None:
raise ValueError(
f"cannot get vendor DNA sequence of strand because at least domain {substrand} has no DNA sequence"
)
ret_list.append(seq)
if self.modification_3p is not None and self.modification_3p.vendor_code is not None:
ret_list.append(self.modification_3p.vendor_code)
return domain_delimiter.join(ret_list)
[docs]
def no_modifications_version(self) -> Strand:
"""
:return: version of this :any:`Strand` with no DNA modifications.
"""
strand_nomods = replace(self, modification_3p=None, modification_5p=None, modifications_int={})
return strand_nomods
# for defining comparables for strongly typed sorting
class Comparable(metaclass=ABCMeta):
@abstractmethod
def __lt__(self, other: Any) -> bool: ...
T = TypeVar("T")
# CT = TypeVar('CT', bound=Comparable)
# KeyFunction = Callable[[T], CT]
KeyFunction = Callable[[T], Any]
[docs]
class StrandOrder(enum.Enum):
"""
Which part of a :any:`Strand` to use for sorting in the
`key function <https://docs.python.org/3/howto/sorting.html#key-functions>`_
returned by :py:meth:`strand_order_key_function`.
"""
five_prime = 0
"""5' end of the strand"""
three_prime = 1
"""3' end of the strand"""
five_or_three_prime = 2
"""Either 5' end or 3' end is used, whichever is first according to the sort order."""
top_left_domain = 3
"""The start offset of the "top-left" :any:`Domain` of the :any:`Strand`: the :any:`Domain` whose
:py:data:`Domain.helix` is minimal, and, among all such :any:`Domain`'s, the one with
minimal :py:data:`Domain.start`."""
[docs]
def strand_order_key_function(*, column_major: bool = True, strand_order: StrandOrder) -> KeyFunction[Strand]:
"""
Returns a `key function <https://docs.python.org/3/howto/sorting.html#key-functions>`_
indicating a sorted order for :any:`Strand`'s. Useful as a parameter for
:py:meth:`Design.`.
:param column_major:
If true, column major order is used: ordered by base offset first, then by helix.
Otherwise row-major order is used: ordered by helix first, then by base offset.
:param strand_order:
Which part of the strand to use as a key for the sorted order.
See :any:`StrandOrder` for definitions.
:return:
A `key function <https://docs.python.org/3/howto/sorting.html#key-functions>`_ that can be
passed to :py:meth:`Design.` to specify a sorted order for the :any:`Strand`'s.
"""
def key(strand: Strand) -> tuple[int, int]:
# we'll return a tuple (helix_idx, offset) for row-major or (offset, helix_idx) for col-major.
helix_idx: int
offset: int
if strand_order == StrandOrder.five_prime:
helix_idx = strand.first_bound_domain().helix
offset = strand.first_bound_domain().offset_5p()
elif strand_order == StrandOrder.three_prime:
helix_idx = strand.last_bound_domain().helix
offset = strand.last_bound_domain().offset_3p()
elif strand_order == StrandOrder.five_or_three_prime:
helix_idx_5p = strand.first_bound_domain().helix
offset_5p = strand.first_bound_domain().offset_5p()
helix_idx_3p = strand.last_bound_domain().helix
offset_3p = strand.last_bound_domain().offset_3p()
if column_major:
offset, helix_idx = min((offset_5p, helix_idx_5p), (offset_3p, helix_idx_3p))
else:
helix_idx, offset = min((helix_idx_5p, offset_5p), (helix_idx_3p, offset_3p))
elif strand_order == StrandOrder.top_left_domain:
helix_idx = strand.first_bound_domain().helix
offset = strand.first_bound_domain().start
for domain in strand.bound_domains():
if (helix_idx, offset) > (domain.helix, domain.start):
helix_idx, offset = domain.helix, domain.start
else:
raise ValueError(f"{strand_order} is not a valid StrandOrder")
if column_major:
return offset, helix_idx
else:
return helix_idx, offset
return key
def _pad_and_remove_whitespace_and_uppercase(sequence: str, strand: Strand, start: int = 0) -> str:
sequence = _remove_whitespace_and_uppercase(sequence)
padded_sequence = _pad_dna(sequence, strand.dna_length(), start)
return padded_sequence
def _remove_whitespace_and_uppercase(sequence: str) -> str:
sequence = re.sub(r"\s*", "", sequence)
sequence = sequence.upper()
return sequence
def _pad_dna(sequence: str, length: int, start: int = 0) -> str:
"""Return `sequence` modified to have length `length`.
If len(sequence) < length, pad with :py:data:`DNA_base_wildcard`.
If len(sequence) > length, remove extra symbols, from 0 up to `start`, and at the end.
:param sequence: sequence to pad
:param length: final length of padded sequence
:param start: index at which to start padding. If not specified, defaults to 0
:return: padded sequence
"""
if start < 0:
raise ValueError(f"cannot pad DNA with negative start, but start = {start}")
elif start >= length:
raise ValueError(f"cannot pad DNA with start >= length, but start = {start} and length = {length}")
if len(sequence) > length:
sequence = sequence[start : start + length]
elif len(sequence) < length:
prefix = DNA_base_wildcard * start
suffix = DNA_base_wildcard * (length - len(sequence) - start)
sequence = prefix + sequence + suffix
return sequence
def _string_merge_wildcard(s1: str, s2: str, wildcard: str) -> str:
"""Takes a "union" of two equal-length strings `s1` and `s2`.
Whenever one has a symbol `wildcard` and the other does not, the result has the non-wildcard symbol.
Raises :py:class:`ValueError` if `s1` and `s2` are not the same length or do not agree on non-wildcard
symbols at any position."""
if len(s1) != len(s2):
raise ValueError(f"\ns1={s1} and\ns2={s2}\nare not the same length.")
union_builder = []
for i in range(len(s1)):
c1, c2 = s1[i], s2[i]
if c1 == wildcard:
union_builder.append(c2)
elif c2 == wildcard:
union_builder.append(c1)
elif c1 != c2:
raise ValueError(f"s1={s1} and s2={s2} have unequal symbols {c1} and {c2} at position {i}.")
elif c1 == c2:
union_builder.append(c1)
else:
raise AssertionError("should be unreachable")
return "".join(union_builder)
[docs]
class IllegalDesignError(ValueError):
"""Indicates that some aspect of the :any:`Design` object is illegal."""
def __init__(self, the_cause: str) -> None:
super().__init__(the_cause)
[docs]
class StrandError(IllegalDesignError):
"""Indicates that the :any:`Design` is illegal due to some specific :any:`Strand`.
Information about the :any:`Strand` is embedded in the error message when this exception is
raised that helps to identify which :any:`Strand` caused the problem."""
def __init__(self, strand: Strand, the_cause: str) -> None:
# need to avoid calling first_bound_domain here to avoid infinite mutual recursion
first_domain: Domain | None
last_domain: Domain | None
if strand.domains is not None and len(strand.domains) > 0 and isinstance(strand.domains[0], Domain):
first_domain = strand.domains[0]
else:
first_domain = None
if strand.domains is not None and len(strand.domains) > 0 and isinstance(strand.domains[-1], Domain):
last_domain = strand.domains[-1]
else:
last_domain = None
msg = f"""{the_cause}
strand length = {strand.dna_length()}
DNA length = {len(strand.dna_sequence) if strand.dna_sequence else "N/A, no DNA sequence assigned"}
DNA sequence = {strand.dna_sequence}
strand 5' helix = {first_domain.helix if first_domain is not None else "N/A"}
strand 5' end offset = {first_domain.offset_5p() if first_domain is not None else "N/A"}
strand 3' helix = {last_domain.helix if last_domain is not None else "N/A"}
strand 3' end offset = {last_domain.offset_3p() if last_domain is not None else "N/A"}\n"""
super().__init__(msg)
# super(IllegalDesignError, self).__init__(msg)
# def _plates(idt_strands) -> list[str]:
# plates: set[str] = set()
# for strand in idt_strands:
# if strand.vendor_fields is not None and strand.vendor_fields.plate is not None:
# plates.add(strand.vendor_fields.plate)
# return list(plates)
_96WELL_PLATE_ROWS: list[str] = ["A", "B", "C", "D", "E", "F", "G", "H"]
_96WELL_PLATE_COLS: list[int] = list(range(1, 13))
_384WELL_PLATE_ROWS: list[str] = ["A", "B", "C", "D", "E", "F", "G", "H", "I", "J", "K", "L", "M", "N", "O", "P"]
_384WELL_PLATE_COLS: list[int] = list(range(1, 25))
[docs]
@enum.unique
class PlateType(int, enum.Enum):
"""Represents two different types of plates in which DNA sequences can be ordered."""
wells96 = 96
"""96-well plate."""
wells384 = 384
"""384-well plate."""
def rows(self) -> list[str]:
return _96WELL_PLATE_ROWS if self is PlateType.wells96 else _384WELL_PLATE_ROWS
def cols(self) -> list[int]:
return _96WELL_PLATE_COLS if self is PlateType.wells96 else _384WELL_PLATE_COLS
[docs]
def num_wells_per_plate(self) -> int:
"""
:return:
number of wells in this plate type
"""
if self is PlateType.wells96:
return 96
elif self is PlateType.wells384:
return 384
else:
raise AssertionError("unreachable")
[docs]
def min_wells_per_plate(self) -> int:
"""
:return:
minimum number of wells in this plate type to avoid extra charge by IDT
"""
if self is PlateType.wells96:
return 24
elif self is PlateType.wells384:
return 96
else:
raise AssertionError("unreachable")
class PlateCoordinate:
def __init__(self, plate_type: PlateType) -> None:
self._plate_type = plate_type
self._plate: int = 1
self._row_idx: int = 0
self._col_idx: int = 0
def advance(self) -> None:
self._row_idx += 1
if self._row_idx == len(self._plate_type.rows()):
self.advance_to_next_col()
if self._col_idx == len(self._plate_type.cols()):
self._col_idx = 0
self._plate += 1
def advance_to_next_col(self) -> None:
self._row_idx = 0
self._col_idx += 1
def plate(self) -> int:
return self._plate
def row(self) -> str:
return self._plate_type.rows()[self._row_idx]
def col(self) -> int:
return self._plate_type.cols()[self._col_idx]
def well(self) -> str:
return f"{self.row()}{self.col()}"
def advance_to_next_plate(self):
self._row_idx = 0
self._col_idx = 0
self._plate += 1
def is_last(self) -> bool:
"""
:return:
whether WellPos is the last well on this type of plate
"""
rows = _96WELL_PLATE_ROWS if self._plate_type == PlateType.wells96 else _384WELL_PLATE_ROWS
cols = _96WELL_PLATE_COLS if self._plate_type == PlateType.wells96 else _384WELL_PLATE_COLS
return self.row == len(rows) and self.col == len(cols)
def remove_helix_idxs_if_default(helices: list[dict]) -> None:
# removes indices from each helix if they are the default (order of appearance in list)
default = True
for expected_idx, helix in enumerate(helices):
idx = helix[idx_on_helix_key]
if idx != expected_idx:
default = False
break
if default:
for helix in helices:
del helix[idx_on_helix_key]
def add_quotes(string: str) -> str:
# adds quotes around a string
return f'"{string}"'
def mandatory_field(ret_type: Type, json_map: dict[str, Any], main_key: str, *, legacy_keys: Sequence[str] = ()) -> Any:
# should be called from function whose return type is the type being constructed from JSON, e.g.,
# Design or Strand, given by ret_type. This helps give a useful error message
keys = (main_key,) + tuple(legacy_keys)
for key in keys:
if key in json_map:
return json_map[key]
ret_type_name = ret_type.__name__
msg_about_keys = f'the key "{main_key}"'
if len(legacy_keys) > 0:
msg_about_keys += f" (or any of the following legacy keys: {', '.join(map(add_quotes, legacy_keys))})"
msg = (
f"I was looking for {msg_about_keys} in the JSON encoding of a {ret_type_name}, "
f"but I did not find it."
f"\n\nThis occurred when reading this JSON object:\n{json_map}"
)
raise IllegalDesignError(msg)
def optional_field(
default_value: Any,
json_map: dict[str, Any],
main_key: str,
*,
legacy_keys: Iterable[str] = (),
transformer: Callable[[Any], Any] | None = None,
) -> Any:
# like dict.get, except that it checks for multiple keys, and it can transform the value if it is the
# wrong type by specifying transformer
keys = (main_key,) + tuple(legacy_keys)
for key in keys:
if key in json_map:
json_value = json_map[key]
if transformer is None:
value = json_value
else:
value = transformer(json_value)
return value
return default_value
##############################################################################
# plate maps
cell_with_border_css_class = "cell-with-border"
# https://bitbucket.org/astanin/python-tabulate/issues/57/html-class-options-for-tables
def _html_row_with_attrs(
celltag: str,
cell_values: Sequence[str],
colwidths: Sequence[int], # noqa
colaligns: Sequence[str],
) -> str:
alignment = {
"left": "",
"right": ' style="text-align: right;"',
"center": ' style="text-align: center;"',
"decimal": ' style="text-align: right;"',
}
values_with_attrs = [
f'<{celltag}{alignment.get(a, "")} class="{cell_with_border_css_class}">{c}</{celltag}>'
for c, a in zip(cell_values, colaligns)
]
return "<tr>" + "".join(values_with_attrs).rstrip() + "</tr>"
# we can't declare a return type because it's TableFormat,
# and we don't want to force the user to install the tabulate package just to import scadnano
def create_html_with_borders_tablefmt(): # type: ignore
from functools import partial
from tabulate import TableFormat, Line
lineabove = Line(
f"""\
<style>
th.{cell_with_border_css_class}, td.{cell_with_border_css_class} {{
border: 1px solid black;
}}
</style>
<table>\
""",
"",
"",
"",
)
html_with_borders_tablefmt = TableFormat( # type: ignore
lineabove=lineabove,
linebelowheader=None,
linebetweenrows=None,
linebelow=Line("</table>", "", "", ""),
headerrow=partial(_html_row_with_attrs, "th"), # type: ignore
datarow=partial(_html_row_with_attrs, "td"), # type: ignore
padding=0,
with_header_hide=None,
)
return html_with_borders_tablefmt
_ALL_TABLEFMTS = [
"plain",
"simple",
"github",
"grid",
"fancy_grid",
"pipe",
"orgtbl",
"jira",
"presto",
"pretty",
"psql",
"rst",
"mediawiki",
"moinmoin",
"youtrack",
"html",
"unsafehtml",
"latex",
"latex_raw",
"latex_booktabs",
"latex_longtable",
"textile",
"tsv",
]
_SUPPORTED_TABLEFMTS_TITLE = [
"github",
"pipe",
"simple",
"grid",
"html",
"unsafehtml",
"rst",
"latex",
"latex_raw",
"latex_booktabs",
"latex_longtable",
]
[docs]
@dataclass
class PlateMap:
"""
Represents a "plate map", i.e., a drawing of a 96-well or 384-well plate, indicating which subset
of wells in the plate have strands. It is an intermediate representation of structured data about
the plate map that is converted to a visual form, such as Markdown, via the export_* methods.
"""
plate_name: str
"""Name of this plate."""
plate_type: PlateType
"""Type of this plate (96-well or 384-well)."""
well_to_strand: dict[str, Strand]
"""dictionary mapping the name of each well (e.g., "C4") to the strand in that well.
Wells with no strand in the PlateMap are not keys in the dictionary."""
def __str__(self) -> str:
return self.to_table()
def _repr_markdown_(self) -> str:
return self.to_table(tablefmt="pipe")
[docs]
def to_table(
self,
well_marker: str | Callable[[str], str] | None = None,
title_level: int = 3,
warn_unsupported_title_format: bool = True,
vertical_borders: bool = False,
tablefmt: str = "pipe",
stralign: str = "default",
missingval: str = "",
showindex: str = "default",
disable_numparse: bool = False,
colalign: Iterable[str | None] | None = None,
) -> str:
"""
Exports this plate map to string format, with a header indicating information such as the
plate's name and volume to pipette. By default the text format is Markdown, which can be
rendered in a jupyter notebook using ``display`` and ``Markdown`` from the package
IPython.display:
.. code-block:: python
plate_maps = design.plate_maps()
maps_strs = '\\n\\n'.join(plate_map.to_table() for plate_map in plate_maps)
from IPython.display import display, Markdown
display(Markdown(maps_strs))
Markdown format is used by default, generating a string such as this:
.. code-block:: none
plate "5 monomer synthesis"
| | 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | 10 | 11 | 12 |
|-----|------|--------|--------|------|----------|-----|-----|-----|-----|------|------|------|
| A | mon0 | mon0_F | | adp0 | | | | | | | | |
| B | mon1 | mon1_Q | mon1_F | adp1 | adp_sst1 | | | | | | | |
| C | mon2 | mon2_F | mon2_Q | adp2 | adp_sst2 | | | | | | | |
| D | mon3 | mon3_Q | mon3_F | adp3 | adp_sst3 | | | | | | | |
| E | mon4 | | mon4_Q | adp4 | adp_sst4 | | | | | | | |
| F | | | | adp5 | | | | | | | | |
| G | | | | | | | | | | | | |
| H | | | | | | | | | | | | |
or, with the :meth:`PlateMap.to_table` parameter `well_marker` set to ``'*'``
(in case you don't need to see the strand names and just want to see which wells are marked):
.. code-block:: none
| | 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | 10 | 11 | 12 |
|-----|-----|-----|-----|-----|-----|-----|-----|-----|-----|------|------|------|
| A | * | * | | * | | | | | | | | |
| B | * | * | * | * | * | | | | | | | |
| C | * | * | * | * | * | | | | | | | |
| D | * | * | * | * | * | | | | | | | |
| E | * | | * | * | * | | | | | | | |
| F | | | | * | | | | | | | | |
| G | | | | | | | | | | | | |
| H | | | | | | | | | | | | |
If `well_marker` is not specified, then each strand must have a name. `well_marker` can also
be a function of the well; for instance, if it is the identity function ``lambda x:x``, then each
well has its own address as the entry:
.. code-block:: none
| | 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | 10 | 11 | 12 |
|-----|-----|-----|-----|-----|-----|-----|-----|-----|-----|------|------|------|
| A | A1 | A2 | | A4 | | | | | | | | |
| B | B1 | B2 | B3 | B4 | B5 | | | | | | | |
| C | C1 | C2 | C3 | C4 | C5 | | | | | | | |
| D | D1 | D2 | D3 | D4 | D5 | | | | | | | |
| E | E1 | | E3 | E4 | E5 | | | | | | | |
| F | | | | F4 | | | | | | | | |
| G | | | | | | | | | | | | |
| H | | | | | | | | | | | | |
This method uses the Python tabulate package (https://pypi.org/project/tabulate/).
The parameters are identical to that of the `tabulate` function and are passed along to it,
except for `tabular_data` and `headers`, which are computed from this plate map.
In particular, the parameter `tablefmt` has default value `'pipe'`,
which creates a Markdown format. To create other formats such as HTML, change the value of
`tablefmt`; see https://github.com/astanin/python-tabulate#readme for other possible formats.
:param well_marker:
By default the strand's name is put in the relevant plate entry. If `well_marker` is specified
and is a string, then that string is put into every well with a strand in the plate map instead.
This is useful for printing plate maps that just put,
for instance, an `'X'` in the well to pipette (e.g., specify ``well_marker='X'``),
e.g., for experimental mixes that use only some strands in the plate.
To enable the string to depend on the well position
(instead of being the same string in every well), `well_marker` can also be a function
that takes as input a string representing the well (such as ``"B3"`` or ``"E11"``),
and outputs a string. For example, giving the identity function
``mix.to_table(well_marker=lambda x: x)`` puts the well address itself in the well.
:param title_level:
The "title" is the first line of the returned string, which contains the plate's name
and volume to pipette. The `title_level` controls the size, with 1 being the largest size,
(header level 1, e.g., # title in Markdown or <h1>title</h1> in HTML)
and 6 being the smallest size.
:param warn_unsupported_title_format:
If True, prints a warning if `tablefmt` is a currently unsupported option for the title.
The currently supported formats for the title are 'github', 'html', 'unsafehtml', 'rst',
'latex', 'latex_raw', 'latex_booktabs', "latex_longtable". If `tablefmt` is another valid
option, then the title will be the Markdown format, i.e., same as for `tablefmt` = 'github'.
:param vertical_borders:
If true, then `tablefmt` must be set to `html` or `unsafehtml`, and the returned
HTML will use inline styles to ensure there are vertical borders between columns of the table.
The vertical borders make it easier to see which column a well is in.
This is useful when rendering in a Jupyter notebook, since the inline styles will be
preserved when saving the Jupyter notebook using the nbconvert tool:
https://nbconvert.readthedocs.io/en/latest/
:param tablefmt:
By default set to `'pipe'` to create a Markdown table. For other options see
https://github.com/astanin/python-tabulate#readme
:param stralign:
See https://github.com/astanin/python-tabulate#readme
:param missingval:
See https://github.com/astanin/python-tabulate#readme
:param showindex:
See https://github.com/astanin/python-tabulate#readme
:param disable_numparse:
See https://github.com/astanin/python-tabulate#readme
:param colalign:
See https://github.com/astanin/python-tabulate#readme
:return:
a string representation of this plate map
"""
if title_level not in [1, 2, 3, 4, 5, 6]:
raise ValueError(f"title_level must be integer from 1 to 6 but is {title_level}")
if tablefmt not in _ALL_TABLEFMTS:
raise ValueError(f"tablefmt {tablefmt} not recognized; choose one of {', '.join(_ALL_TABLEFMTS)}")
elif tablefmt not in _SUPPORTED_TABLEFMTS_TITLE and warn_unsupported_title_format:
print(
f"{'*' * 99}\n* WARNING: title formatting not supported for tablefmt = {tablefmt}; "
f"using Markdown format\n{'*' * 99}"
)
if vertical_borders and tablefmt not in ["html", "unsafehtml"]:
raise ValueError(
"parameter vertical_borders only supported when tablefmt is "
f'"html" or "unsafehtml", but tablefmt = {tablefmt}'
)
num_rows = len(self.plate_type.rows())
num_cols = len(self.plate_type.cols())
table = [[" " for _ in range(num_cols + 1)] for _ in range(num_rows)]
for r in range(num_rows):
table[r][0] = self.plate_type.rows()[r]
coord = PlateCoordinate(self.plate_type)
for c in range(1, num_cols + 1):
for r in range(num_rows):
well = coord.well()
if well in self.well_to_strand:
strand = self.well_to_strand[well]
if isinstance(well_marker, str):
well_marker_to_use = well_marker
elif callable(well_marker):
well_marker_to_use = well_marker(well)
elif well_marker is None and strand.name is not None:
well_marker_to_use = strand.name
elif well_marker is None and strand.name is None:
raise ValueError(
f"strand {strand} has no name, and well_marker was not specified, "
f"but well_marker must be specified if including a nameless "
f"strand in the plate map"
)
else:
raise ValueError(
f"invalid type of well_marker = {well_marker}; must be a "
f"string or a function mapping strings to strings, but is a "
f"{type(well_marker)}"
)
table[r][c] = well_marker_to_use
if not coord.is_last():
coord.advance()
raw_title = f'plate "{self.plate_name}"'
title = _format_title(raw_title, title_level, tablefmt)
header = [" "] + [str(col) for col in self.plate_type.cols()]
# wait until just before we need it to produce non-str TableFormat, so that we don't need
# to require the TableFormat type in type declarations, which would add a tabulate dependency
# for scadnano users even if they don't use plate maps
from tabulate import TableFormat, tabulate
tablefmt_typed: str | TableFormat = tablefmt
if vertical_borders:
tablefmt_typed = create_html_with_borders_tablefmt()
out_table = tabulate(
tabular_data=table,
headers=header,
tablefmt=tablefmt_typed,
stralign=stralign,
missingval=missingval,
showindex=showindex,
disable_numparse=disable_numparse,
colalign=colalign,
)
table_with_title = f"{title}\n{out_table}"
return table_with_title
def _plate_map(plate_name: str, strands_in_plate: list[Strand], plate_type: PlateType) -> PlateMap:
"""
Generates plate map from this :any:`Design` for plate with name `plate_name`.
All :any:`Strand`'s in the design that have a field :data:`Strand.vendor_fields` with
:data:`Strand.vendor_fields.plate` with value `plate_name` are exported.
:return:
plate map for :any:`Strand`'s with :data:`Strand.vendor_fields.plate` equal to`plate_name`
"""
well_to_strand = {}
for strand in strands_in_plate:
if strand.vendor_fields is None:
raise ValueError(f"strand {strand} has no idt field, so cannot be included in the plate map")
elif strand.vendor_fields.well is None:
raise ValueError(f"strand {strand} has no idt.well field, so cannot be included in the plate map")
well_to_strand[strand.vendor_fields.well] = strand
plate_map = PlateMap(
plate_name=plate_name,
plate_type=plate_type,
well_to_strand=well_to_strand,
)
return plate_map
def _format_title(
raw_title: str,
level: int,
tablefmt: str,
) -> str:
# formats a title for a table produced using tabulate,
# in the formats tabulate understands
if tablefmt in ["html", "unsafehtml"]:
title = f"<h{level}>{raw_title}</h{level}>"
elif tablefmt == "rst":
# https://draft-edx-style-guide.readthedocs.io/en/latest/ExampleRSTFile.html#heading-levels
# #############
# Heading 1
# #############
#
# *************
# Heading 2
# *************
#
# ===========
# Heading 3
# ===========
#
# Heading 4
# ************
#
# Heading 5
# ===========
#
# Heading 6
# ~~~~~~~~~~~
raw_title_width = len(raw_title)
if level == 1:
line = "#" * raw_title_width
elif level in [2, 4]:
line = "*" * raw_title_width
elif level in [3, 5]:
line = "=" * raw_title_width
else:
line = "~" * raw_title_width
if level in [1, 2, 3]:
title = f"{line}\n{raw_title}\n{line}"
else:
title = f"{raw_title}\n{line}"
elif tablefmt in ["latex", "latex_raw", "latex_booktabs", "latex_longtable"]:
if level == 1:
size = r"\Huge"
elif level == 2:
size = r"\huge"
elif level == 3:
size = r"\LARGE"
elif level == 4:
size = r"\Large"
elif level == 5:
size = r"\large"
elif level == 6:
size = r"\normalsize"
else:
assert False
newline = r"\\"
noindent = r"\noindent"
title = f"{noindent} {{ {size} {raw_title} }} {newline}"
else: # use the title for tablefmt == "pipe"
hashes = "#" * level
title = f"{hashes} {raw_title}"
return title
# end plate maps
#############################################################################
def _check_helices_view_order_and_return(helices_view_order: list[int] | None, helix_idxs: Iterable[int]) -> list[int]:
if helices_view_order is None:
identity = sorted(helix_idxs)
helices_view_order = identity
else:
_check_helices_view_order_is_bijection(helices_view_order, helix_idxs)
return helices_view_order
def _check_helices_grid_legal(grid: Grid, helices: Iterable[Helix]) -> None:
for helix in helices:
if grid == Grid.none and helix.grid_position is not None:
raise IllegalDesignError(f"grid is none, but Helix {helix.idx} has grid_position = {helix.grid_position}")
elif grid != Grid.none and helix.position is not None:
raise IllegalDesignError(f"grid is not none, but Helix {helix.idx} has position = ${helix.position}")
def _check_helices_view_order_is_bijection(helices_view_order: list[int], helix_idxs: Iterable[int]) -> None:
if not (sorted(helices_view_order) == sorted(helix_idxs)):
raise IllegalDesignError(
f"The specified helices view order: {helices_view_order}\n "
f"is not a bijection on helices indices: {helix_idxs}."
)
def _check_type(obj: Any, expected_type) -> None:
# check that `obj` is of type `expected_type`
if not isinstance(obj, expected_type):
raise IllegalDesignError(
f"I expected the object {obj} to be of type {expected_type}, but instead it is of type {type(obj)}"
)
def _check_type_is_one_of(obj: Any, expected_types: Iterable) -> None:
# check that `obj` is one of the types in `expected_types`
for expected_type in expected_types:
if isinstance(obj, expected_type):
return
raise IllegalDesignError(
f"I expected the object {obj} to be one of the types {expected_types}, but instead it is of type {type(obj)}"
)
def find_overlapping_domains_on_helix(helix: Helix) -> list[tuple[Domain, Domain]]:
# compute list of pairs of domains that overlap on Helix `helix`
# assumes that `helix.domains` has been populated by calling `Design._build_domains_on_helix_lists()`
forward_domains = []
reverse_domains = []
for domain in helix.domains:
if domain.forward:
forward_domains.append(domain)
else:
reverse_domains.append(domain)
forward_domains.sort(key=lambda dom: dom.start)
reverse_domains.sort(key=lambda dom: dom.start)
if len(forward_domains) == 0 or len(reverse_domains) == 0:
return []
# need to be efficient to remove the front element repeatedly
reverse_domains = collections.deque(reverse_domains)
overlapping_domains = []
for forward_domain in forward_domains:
reverse_domain = reverse_domains[0]
# remove each reverse_domain that strictly precedes forward domain
# they cannot overlap forward_domain nor any domain following it in the list forward_domains
while reverse_domain.end <= forward_domain.start and len(reverse_domains) > 0:
reverse_domains.popleft()
if len(reverse_domains) > 0:
reverse_domain = reverse_domains[0]
else: # if all reverse domains are gone, we're done
return overlapping_domains
# otherwise we may have found an overlapping reverse_domain, OR forward_domain could precede it
# if forward_domain precedes reverse_domain, next inner loop is skipped,
# and we go to next forward_domain in the outer loop
# add each reverse_domain that overlaps forward_domain
while forward_domain.overlaps(reverse_domain):
overlapping_domains.append((forward_domain, reverse_domain))
if reverse_domain.end <= forward_domain.end:
# [-----f_dom--->[--next_f_dom-->
# [--r_dom--->
# reverse_domain can't overlap *next* forward_domain, so safe to remove
reverse_domains.popleft()
if len(reverse_domains) > 0:
reverse_domain = reverse_domains[0]
else:
break
else:
# [---f_dom---> [---next_f_dom-->
# [----r_dom->[--next_r_dom---->
# reverse_domain possibly overlaps next forward_domain, so keep it in queue
# but this is last reverse_domain overlapping current forward_domain, so safe to break loop
break
return overlapping_domains
[docs]
def bases_complementary(base1: str, base2: str, allow_wildcard: bool = False, allow_none: bool = False) -> bool:
"""
Indicates if `base1` and `base2` are complementary DNA bases.
:param base1:
first DNA base
:param base2:
second DNA base
:param allow_wildcard:
if true a "wildcard" (the symbol '?') is considered to be complementary to anything
:param allow_none:
if true the object None is considered to be complementary to anything
:return:
whether `base1` and `base2` are complementary DNA bases
"""
if allow_none and (base1 is None or base2 is None):
return True
elif not allow_none and (base1 is None or base2 is None):
return False
if allow_wildcard and (base1 == DNA_base_wildcard or base2 == DNA_base_wildcard):
return True
if len(base1) != 1 or len(base2) != 1:
raise ValueError(f"base1 and base2 must each be a single character: base1 = {base1}, base2 = {base2}")
base1 = base1.upper()
base2 = base2.upper()
return {base1, base2} == {"A", "T"} or {base1, base2} == {"C", "G"}
[docs]
def reverse_complementary(seq1: str, seq2: str, allow_wildcard: bool = False, allow_none: bool = False) -> bool:
"""
Indicates if `seq1` and `seq2` are reverse complementary DNA sequences.
:param seq1:
first DNA sequence
:param seq2:
second DNA sequence
:param allow_wildcard:
if true a "wildcard" (the symbol '?') is considered to be complementary to anything
:param allow_none:
if true the object None is considered to be complementary to anything
:return:
whether `seq1` and `seq2` are reverse complementary DNA sequences
"""
if allow_none and (seq1 is None or seq2 is None):
return True
elif not allow_none and (seq1 is None or seq2 is None):
return False
if len(seq1) != len(seq2):
return False
for b1, b2 in zip(seq1, seq2[::]):
if not bases_complementary(b1, b2, allow_wildcard, allow_none):
return False
return True
[docs]
@dataclass
class Design(_JSONSerializable):
"""Object representing the entire design of the DNA structure."""
strands: list[Strand]
"""All of the :any:`Strand`'s in this :any:`Design`.
Required field."""
helices: dict[int, Helix]
"""All of the :any:`Helix`'s in this :any:`Design`.
This is a dictionary mapping index to the :any:`Helix` with that index; if helices have indices
0, 1, ..., num_helices-1, then this can be used as a list of Helices.
Optional field. If not specified, then the number of helices will be just large enough to store the
largest index :py:data:`Domain.helix`
stored in any :any:`Domain`
in :py:data:`Design.strands`."""
groups: dict[str, HelixGroup]
""":any:`HelixGroup`'s in this :any:`Design`."""
geometry: Geometry = field(default_factory=lambda: Geometry())
"""Controls some geometric/physical aspects of this :any:`Design`."""
automatically_assign_color: bool = field(repr=False, default=True)
"""If `automatically_assign_color` = ``False``, then for any :any:`Strand` such that
`Strand.color` = ``None``, do not automatically assign a :any:`Color` to it.
In this case color will be set to its default of ``None`` and will not be
written to the JSON with :py:meth:`Design.write_scadnano_file` or :py:meth:`Design.to_json`."""
color_cycler: ColorCycler = field(default_factory=lambda: ColorCycler(), init=False)
def __init__(
self,
*,
helices: list[Helix] | dict[int, Helix] | None = None,
groups: dict[str, HelixGroup] | None = None,
strands: Iterable[Strand] | None = None,
grid: Grid = Grid.none,
helices_view_order: list[int] | None = None,
geometry: Geometry | None = None,
) -> None:
"""
:param helices:
list of :any:`Helix`'s; if missing, set based on `strands`.
:param groups:
dict mapping group name to :any:`HelixGroup`.
Mutually exclusive with `helices_view_order`, and any non-none :any:`Grid`. If set, then each
:any:`Helix` must have its :py:data:`Helix.group` field set to a group name that is one of the
keys of this dict.
:param strands:
list of :any:`Strand`'s. If missing, will be empty.
:param grid:
:any:`Grid` to use; if not the default value of :data:`Grid.none`, then it is
mutually exclusive with `groups`.
:param helices_view_order:
order in which to view helices from top to bottom in web interface main view.
Mutually exclusive with `groups`.
This list must contain each :py:data:`Helix.idx` exactly once.
If no :py:data:`Helix.idx` is explicitly specified, then this should be a permutation of the
list [0,1,...,len(helices)-1].
default is to display in increasing order of :py:data:`Helix.idx`.
:param geometry: geometric physical parameters for visualization.
If not specified, a default set of parameters from the literature are used.
"""
using_groups = groups is not None
if helices_view_order is not None and using_groups:
raise IllegalDesignError(
"Design.helices_view_order and Design.groups are mutually exclusive. Set at most one of them."
)
if grid != Grid.none and using_groups:
raise IllegalDesignError("Design.grid and Design.groups are mutually exclusive. Set at most one of them.")
self.strands = [] if strands is None else list(strands)
self.color_cycler = ColorCycler()
self.geometry = Geometry() if geometry is None else geometry
if groups is None:
self.groups = {default_group_name: HelixGroup()}
else:
self.groups = groups
if grid != Grid.none:
raise IllegalDesignError(
"cannot use a non-none grid for whole Design when helix groups are "
"used; only the HelixGroups can have non-none grids in this case"
)
if helices_view_order is not None:
raise IllegalDesignError(
"cannot use helices_view_order for whole Design when helix groups "
"are used; only the HelixGroups can have helices_view_order "
"in this case"
)
if helices is None:
if len(self.strands) > 0:
max_helix_idx = max(domain.helix for strand in self.strands for domain in strand.bound_domains())
helices = {idx: Helix(idx=idx) for idx in range(max_helix_idx + 1)}
else:
helices = {}
elif not (isinstance(helices, dict) or isinstance(helices, list)):
raise IllegalDesignError(
"type of parameter helices must be list of helices, "
f"dict mapping int to helices, or None, but it is {type(helices)}"
)
self.helices = Design._normalize_helices_as_dict(helices)
# set up helices_view_order in groups
uses_default_group = self._has_default_groups()
for name, group in self.groups.items():
helix_idxs_in_group = self.helices_idxs_in_group(name)
if uses_default_group:
helices_view_order_for_group = helices_view_order
grid_for_group = grid
else:
helices_view_order_for_group = group.helices_view_order
grid_for_group = group.grid
group.helices_view_order = _check_helices_view_order_and_return(
helices_view_order_for_group, helix_idxs_in_group
)
if grid_for_group is None:
raise AssertionError()
group.grid = grid_for_group
helices_in_group = [self.helices[idx] for idx in helix_idxs_in_group]
_check_helices_grid_legal(group.grid, helices_in_group)
self.__post_init__()
def __post_init__(self) -> None:
# XXX: exact order of these calls is important
self._ensure_helices_distinct_objects()
self._ensure_strands_distinct_objects()
self._set_helices_grid_positions_or_positions()
self._build_domains_on_helix_lists()
self._set_helices_min_max_offsets(update=False)
self._ensure_helix_groups_exist()
self._assign_default_helices_view_orders_to_groups()
self._check_legal_design()
if self.automatically_assign_color:
self._assign_colors_to_strands()
@property
def helices_view_order(self) -> list[int]:
"""
Return helices_view_order of this :any:`Design` if no :any:`HelixGroup`'s are being used, otherwise
raise a ValueError.
:return: helices_view_order of this :any:`Design`
"""
group = self._get_default_group()
if group.helices_view_order is None:
raise ValueError(f"group {group} does not have helices_view_order defined")
return group.helices_view_order
@property
def grid(self) -> Grid:
"""
Return grid of this :any:`Design` if no :any:`HelixGroup`'s are being used, otherwise
raise a ValueError.
:return: grid of this :any:`Design`
"""
group = self._get_default_group()
return group.grid
[docs]
def set_grid(self, grid: Grid) -> None:
"""
Sets the grid of the default :any:`HelixGroup`, if the default is being used,
otherwise raises an exception.
:param grid:
new grid to set for the (only) :any:`HelixGroup` in this :any:`Design`
:raises IllegalDesignError:
if there is more than one :any:`HelixGroup` in this :any:`Design`
"""
group = self._get_default_group()
group.grid = grid
def _get_default_group(self) -> HelixGroup:
# Gets default group and raise exception if default group is not being used
if not self._has_default_groups():
raise ValueError("The default group is not being used for this design.")
if self.groups is None:
raise AssertionError("Design.groups should not be None by this point")
groups: list[HelixGroup] = list(self.groups.values())
group: HelixGroup = groups[0]
return group
[docs]
def helices_idxs_in_group(self, group_name: str) -> list[int]:
"""
Indexes of :any:`Helix`'s in this group. Must be associated with a :any:`Design` for this to work.
:param group_name: name of group
:return: list of indices of :any:`Helix`'s in this :any:`HelixGroup`
"""
return [idx for idx, helix in self.helices.items() if helix.group == group_name]
def _assign_colors_to_strands(self) -> None:
# if color not specified, pick one by cycling through list of staple colors,
# unless caller specified not to
for strand in self.strands:
self._assign_color_to_strand(strand)
def _assign_color_to_strand(self, strand: Strand) -> None:
if strand.color is None and self.automatically_assign_color:
if strand.is_scaffold:
strand.color = default_scaffold_color
else:
strand.color = next(self.color_cycler)
[docs]
def pitch_of_helix(self, helix: Helix) -> float:
"""Same as the pitch of helix's :any:`HelixGroup`"""
return self.groups[helix.group].pitch
[docs]
def yaw_of_helix(self, helix: Helix) -> float:
"""Same as the yaw of helix's :any:`HelixGroup`"""
return self.groups[helix.group].yaw
[docs]
def roll_of_helix(self, helix: Helix) -> float:
"""Roll of helix's :any:`HelixGroup` plus :py:data:`Helix.roll`"""
return self.groups[helix.group].roll + helix.roll
[docs]
@staticmethod
def from_scadnano_file(filename: str) -> Design:
"""
Loads a :any:`Design` from the file with the given name.
:param filename: name of the file with the design. Should be a JSON file ending in .sc
:return: Design described in the file
"""
with open(filename) as f:
json_str = f.read()
return Design.from_scadnano_json_str(json_str)
[docs]
@staticmethod
def from_scadnano_json_str(json_str: str) -> Design:
"""
Loads a :any:`Design` from the given JSON string.
:param json_str: JSON description of the :any:`Design`
:return: Design described in the JSON string
"""
json_map = json.loads(json_str)
try:
design = Design.from_scadnano_json_map(json_map)
return design
except KeyError as error:
raise IllegalDesignError(f"I was expecting a JSON key but did not find it: {error}")
@staticmethod
def _check_mutually_exclusive_fields(json_map: dict) -> None:
exclusive_pairs = [
(grid_key, groups_key),
(helices_view_order_key, groups_key),
]
for key1, key2 in exclusive_pairs:
if key1 in json_map and key2 in json_map:
raise IllegalDesignError(f'cannot specify both "{key1}" and "{key2}" in Design JSON')
@staticmethod
def _num_helix_groups(json_map: dict) -> int:
num_groups_used = 0
if groups_key in json_map:
num_groups_used = len(json_map[groups_key])
return num_groups_used
@staticmethod
def _helices_from_json(
json_map: dict,
) -> tuple[
list[Helix],
dict[str, tuple[float, float, int]],
dict[tuple[float, float], list[Helix]],
]:
"""Returns list of helices as well as two maps, group_to_pitch_yaw, and pitch_yaw_to_helices
group_to_pitch_yaw is filled if multiple helix groups are used
- maps group name to pitch, yaw, and helix idx of a helix in that group (the first one found)
pitch_yaw_to_helices is filled if a single helix group is used
- maps pitch and yaw pairs to list of helix with those pitch and yaw
These maps are used to convert designs that have helices with individual pitches and yaws
into designs where helices do not have individual pitches and yaws.
Pass these two maps into _groups_from_json so that groups can be assigned appropriate pitch, yaw values.
"""
# Initialize return values
helices = []
group_to_pitch_yaw: dict[str, tuple[float, float, int]] = {}
pitch_yaw_to_helices: dict[tuple[float, float], list[Helix]] = defaultdict(list)
# Useful booleans
multiple_groups_used = Design._num_helix_groups(json_map) > 1
single_group_used = not multiple_groups_used
using_groups = groups_key in json_map
grid: Grid = optional_field(Grid.none, json_map, grid_key, transformer=Grid)
grid_is_none = grid == Grid.none
idx_default = 0
deserialized_helices_list = json_map[helices_key]
for helix_json in deserialized_helices_list:
helix = Helix.from_json(helix_json)
helix_idx = helix.idx if helix.idx is not None else idx_default
#########################################################################
# BEGIN Backward Compatibility Code for Helix With Individual Pitch/Yaw #
#########################################################################
# Handle pitch and yaw for individual helices
pitch = 0 if pitch_key not in helix_json else helix_json[pitch_key]
yaw = 0 if yaw_key not in helix_json else helix_json[yaw_key]
group = helix.group
if multiple_groups_used:
if group not in group_to_pitch_yaw:
# Log pitch and yaw for a helix in group so that other helices in the group can be compared
group_to_pitch_yaw[group] = (pitch, yaw, helix_idx)
else:
# Another helix in this group also had a non-zero pitch/yaw, so check if they match
expected_pitch, expected_yaw, idx_of_helix_with_expected_pitch_yaw = group_to_pitch_yaw[group]
if not (_is_close(pitch, expected_pitch) and _is_close(yaw, expected_yaw)):
raise IllegalDesignError(
f"In HelixGroup {group}, Helix {helix_idx} has pitch {pitch} and yaw {yaw} but Helix {helix_idx} has pitch {expected_pitch} and yaw {expected_yaw}. Please seperate Helix {helix_idx} and Helix {idx_of_helix_with_expected_pitch_yaw} into seperate HelixGroups."
)
if single_group_used:
is_new_pitch_yaw = True
# Search for a pitch yaw pair that is close to pitch yaw of helix
for p, y in pitch_yaw_to_helices:
if _is_close(p, pitch) and _is_close(y, yaw):
pitch_yaw_to_helices[(p, y)].append(helix)
is_new_pitch_yaw = False
break
# If no pitch yaw pair found, then create a new one and add to dictionary
if is_new_pitch_yaw:
pitch_yaw_to_helices[(pitch, yaw)].append(helix)
#######################################################################
# END Backward Compatibility Code for Helix With Individual Pitch/Yaw #
#######################################################################
if not using_groups and grid_is_none and grid_position_key in helix_json:
raise IllegalDesignError(
f"grid is none, but Helix {helix_idx} has grid_position = {helix_json[grid_position_key]}"
)
elif not using_groups and not grid_is_none and position_key in helix_json:
raise IllegalDesignError(
f"grid is not none, but Helix {helix_idx} has position = ${helix_json[position_key]}"
)
helices.append(helix)
idx_default += 1
return helices, group_to_pitch_yaw, pitch_yaw_to_helices
@staticmethod
def _groups_and_grid_from_json(
json_map: dict,
helices: list[Helix],
group_to_pitch_yaw: dict[str, tuple[float, float, int]],
pitch_yaw_to_helices: dict[tuple[float, float], list[Helix]],
) -> tuple[dict[str, HelixGroup], Grid]:
"""Returns map of helix group names to group as well as the grid.
If multiple helix groups are used, then groups pitch and yaw will be the
pitch and yaw given in the json map plus the pitch and yaw values
provided in group_to_pitch_yaw.
If a single helix group is used, then new helix groups will be created using
the provided group_to_pitch_yaw map. Because new helix groups are created,
helices will be modfied so that each helix's group field is set to the new
group it has been assigned to.
In most cases, grid will simply be what is given in the json_map.
There is a special case where if the default helix group is used,
then the grid may be initially set to some value. If individual helix
pitch and rolls were set, then new helix groups are created, meaning
the grid field is no longer valid.
"""
groups = None
grid: Grid = optional_field(Grid.none, json_map, grid_key, transformer=Grid)
# Get helix groups provided from json_map
if groups_key in json_map:
groups_json = json_map[groups_key]
groups = {}
for name, group_json in groups_json.items():
num_helices_in_group = sum(1 for helix in helices if helix.group == name)
groups[name] = HelixGroup.from_json(group_json, num_helices=num_helices_in_group)
#########################################################################
# BEGIN Backward Compatibility Code for Helix With Individual Pitch/Yaw #
#########################################################################
multiple_groups_used = Design._num_helix_groups(json_map) > 1
single_group_used = not multiple_groups_used
# Add individual helix pitch and yaw
if multiple_groups_used:
assert groups is not None
for group_name, (pitch, yaw, _) in group_to_pitch_yaw.items():
groups[group_name].pitch += pitch
groups[group_name].yaw += yaw
# Add new helix groups if individual helix pitch and yaw set
if single_group_used:
# New groups to add
new_groups: dict[str, HelixGroup] = {}
# The only group (take into account case when default helix group is used)
group = list(groups.values())[0] if groups is not None else HelixGroup()
for (helix_pitch, helix_yaw), helix_list in pitch_yaw_to_helices.items():
new_pitch = group.pitch + helix_pitch
new_yaw = group.yaw + helix_yaw
# Only make new groups if helix's pitch/yaw is non-zero
if helix_pitch or helix_yaw:
# If there is more than one helix, create new helix group for each pitch yaw value
new_group_name = f"pitch_{new_pitch}_yaw_{new_yaw}"
new_groups[new_group_name] = HelixGroup(pitch=new_pitch, yaw=new_yaw, grid=group.grid)
# Move helices into new group
for helix in helix_list:
helix.group = new_group_name
if len(new_groups) != 0:
if groups is not None:
groups.update(new_groups)
else:
groups = new_groups
# Change grid to none because multiple helix groups are now used
# so grid can no longer be specified
grid = Grid.none
#######################################################################
# END Backward Compatibility Code for Helix With Individual Pitch/Yaw #
#######################################################################
return groups, grid
@staticmethod
def _helices_and_groups_and_grid_from_json(
json_map: dict,
) -> tuple[
list[Helix],
dict[str, HelixGroup],
Grid,
]:
helices, group_to_pitch_yaw, pitch_yaw_to_helices = Design._helices_from_json(json_map)
groups, grid = Design._groups_and_grid_from_json(json_map, helices, group_to_pitch_yaw, pitch_yaw_to_helices)
return helices, groups, grid
[docs]
@staticmethod
def from_scadnano_json_map(json_map: dict) -> Design:
"""
Loads a :any:`Design` from the given JSON object (i.e., Python object obtained by calling
json.loads(json_str) from a string representing contents of a JSON file.
:param json_map: map describing the :any:`Design`;
should be JSON serializable via ``encode(json_map)``
:return: :any:`Design` described in the object
"""
# version = json_map.get(version_key, initial_version) # not sure what to do with version
Design._check_mutually_exclusive_fields(json_map)
# helices, groups, and grid
helices, groups, grid = Design._helices_and_groups_and_grid_from_json(json_map)
num_helices = len(helices)
# view order of helices
helices_view_order = json_map.get(helices_view_order_key)
if helices_view_order is not None:
helix_idxs = [helix.idx for helix in helices]
if len(helices_view_order) != num_helices:
raise IllegalDesignError(
f"length of helices ({num_helices}) does not match "
f"length of helices_view_order ({len(helices_view_order)})"
)
if sorted(helices_view_order) != sorted(helix_idxs):
raise IllegalDesignError(
f"helices_view_order = {helices_view_order} is not a permutation of the set of helices {helix_idxs}"
)
# strands
strands = []
strand_jsons = mandatory_field(Design, json_map, strands_key)
for strand_json in strand_jsons:
strand = Strand.from_json(strand_json)
strands.append(strand)
mods_5p: dict[str, Modification5Prime] = {}
mods_3p: dict[str, Modification3Prime] = {}
mods_int: dict[str, ModificationInternal] = {}
for all_mods_key, mods in zip(
[design_modifications_5p_key, design_modifications_3p_key, design_modifications_int_key],
[mods_5p, mods_3p, mods_int],
):
if all_mods_key in json_map:
all_mods_json = json_map[all_mods_key]
for mod_key, mod_json in all_mods_json.items():
mod = Modification.from_json(mod_json)
if mod_key != mod.vendor_code:
print(
f"WARNING: key {mod_key} does not match vendor_code field {mod.vendor_code}"
f"for modification {mod}\n"
f"replacing with key = {mod.vendor_code}"
)
mod = dataclasses.replace(mod, vendor_code=mod_key)
mods[mod_key] = mod
# legacy code; now we stored modifications in 3 separate dicts depending on 5', 3', internal
all_mods: dict[str, Modification] = {}
if design_modifications_key in json_map:
all_mods_json = json_map[design_modifications_key]
for mod_key, mod_json in all_mods_json.items():
mod = Modification.from_json(mod_json)
if mod_key != mod.vendor_code:
print(
f"WARNING: key {mod_key} does not match vendor_code field {mod.vendor_code}"
f"for modification {mod}\n"
f"replacing with key = {mod.vendor_code}"
)
mod_key = mod.vendor_code
all_mods[mod_key] = mod
Design.assign_modifications_to_strands(strands, strand_jsons, mods_5p, mods_3p, mods_int, all_mods)
geometry = None
if geometry_key in json_map:
geometry = Geometry.from_json(json_map[geometry_key])
return Design(
helices=helices,
groups=groups,
strands=strands,
grid=grid,
helices_view_order=helices_view_order,
geometry=geometry,
)
def to_json_serializable(self, suppress_indent: bool = True, **kwargs: Any) -> dict[str, Any]:
dct: dict[str, Any] = OrderedDict()
dct[version_key] = __version__
if self._has_default_groups():
dct[grid_key] = str(self.grid)[5:] # remove prefix 'Grid.'
if not self.geometry.is_default():
dct[geometry_key] = self.geometry.to_json_serializable(suppress_indent)
if not self._has_default_groups():
group_map = {}
for name, group in self.groups.items():
helix_idxs_in_group = [helix.idx for helix in self.helices.values() if helix.group == name]
group_map[name] = group.to_json_serializable(suppress_indent, helix_idxs=helix_idxs_in_group)
dct[groups_key] = group_map
helices_json = []
for helix in self.helices.values():
group = self.groups[helix.group]
helix_json = helix.to_json_serializable(suppress_indent, grid=group.grid)
helices_json.append(helix_json)
dct[helices_key] = helices_json
# remove idx key from list of helices if they have the default index
unwrapped_helices = list(dct[helices_key])
if len(unwrapped_helices) > 0:
for i, wrapped in enumerate(unwrapped_helices):
if isinstance(wrapped, NoIndent):
unwrapped_helices[i] = wrapped.value
remove_helix_idxs_if_default(unwrapped_helices)
if self._has_default_groups():
default_helices_view_order = sorted(self.helices.keys())
if self.helices_view_order != default_helices_view_order:
dct[helices_view_order_key] = (
NoIndent(self.helices_view_order) if suppress_indent else self.helices_view_order
)
# modifications
for mod_type in [ModificationType.five_prime, ModificationType.three_prime, ModificationType.internal]:
mods = self.modifications(mod_type)
if len(mods) > 0:
mods_dict = {}
for mod in mods:
if mod.vendor_code not in mods_dict:
mods_dict[mod.vendor_code] = mod.to_json_serializable(suppress_indent)
else:
if mod != mods_dict[mod.vendor_code]:
raise IllegalDesignError(
f"Modifications of type {mod_type} must have unique vendor codes, "
f"but I foundtwo different Modifications of that type "
f"that share vendor code "
f"{mod.vendor_code}:\n{mod}\nand\n"
f"{mods_dict[mod.vendor_code]}"
)
dct[mod_type.key()] = mods_dict
dct[strands_key] = [strand.to_json_serializable(suppress_indent) for strand in self.strands]
for helix_list_order, helix in enumerate(self.helices.values()):
helix_json_maybe: NoIndent | dict[str, Any] = dct[helices_key][helix_list_order]
if isinstance(helix_json_maybe, NoIndent):
helix_json = helix_json_maybe.value # get past NoIndent surrounding helix, if it is there
else:
helix_json = helix_json_maybe
# XXX: no need to check here because key was already deleted by Helix.to_json_serializable
# max_offset still needs to be checked here since it requires global knowledge of Strands
# if 0 == helix_json[min_offset_key]:
# del helix_json[min_offset_key]
max_offset = max((domain.end for strand in self.strands for domain in strand.bound_domains()), default=-1)
if max_offset == helix_json[max_offset_key] or helix_json[max_offset_key] is None:
del helix_json[max_offset_key]
return dct
@property
def scaffold(self) -> Strand | None:
"""Returns the first scaffold in this :any:`Design`, if there is one, or ``None`` otherwise."""
for strand in self.strands:
if strand.is_scaffold:
return strand
return None
@staticmethod
def _normalize_helices_as_dict(helices: list[Helix] | dict[int, Helix]) -> dict[int, Helix]:
if isinstance(helices, list):
helix_pos_no_idx = None
helix_pos_with_idx = None
for idx, helix in enumerate(helices):
if helix.idx >= 0 and helix_pos_with_idx is None:
helix_pos_with_idx = idx
elif helix.idx < 0 and helix_pos_no_idx is None:
helix_pos_no_idx = idx
if helix_pos_no_idx is not None and helix_pos_with_idx is not None:
raise IllegalDesignError(
"When specifying helices as a list, either all helices must have idx < 0 "
"or all helices must have idx >= 0, but I found helix "
f"{helices[helix_pos_no_idx]} has idx < 0 (indicating no explicitly assigned helix idx) and "
f"helix {helices[helix_pos_with_idx]} has idx >= 0"
)
# if helices do not have idx's set; set them base on their position in the list
if helix_pos_no_idx is not None:
for idx, helix in enumerate(helices):
if helix.idx < 0:
helix.idx = idx
indices = [helix.idx for helix in helices]
if len(set(indices)) < len(indices):
duplicates = [index for index, count in Counter(indices).items() if count > 1]
raise IllegalDesignError(
"No two helices can share an index, but these indices appear on "
f"multiple helices: {', '.join(map(str, duplicates))}"
)
helices = {helix.idx: helix for helix in helices}
else:
for idx, helix in helices.items():
if helix.idx >= 0:
if helix.idx != idx:
raise IllegalDesignError(
"When specifying helices as a dict, each helix's idx field must match its key in the dict,"
"or must be unspecified (-1), "
f"but I found helix {helix} has idx {helix.idx} but is at key {idx}"
)
else:
helix.idx = idx
return helices
[docs]
def base_pairs(self, allow_mismatches: bool = False) -> dict[int, list[int]]:
"""
Base pairs in this design, represented as a dict mapping a :data:`Helix.idx` to a list of offsets
on that helix where two strands are.
If a :any:`Helix` has no base pairs, then its :data:`Helix.idx` is not a key in the returned dict.
An offset with a deletion on either :any:`Domain` is not considered a base pair.
Insertions are more complex. If `allow_mismatches` is False, then an offset with an insertion on
*both* :any:`Domain`'s is considered a *single* base pair so long as the DNA sequences on each
insertion are the same length and complementary. If `allow_mismatches` is True then an offset with
an insertion on *either* :any:`Domain`'s is considered a *single* base pair regardless of the
length or DNA sequences of either insertion.
To calculate "true" base pairs in the presence of deletions and insertions, it is recommended
first to remove the deletions and insertions using the method
:meth:`Design.inline_deletions_insertions`.
:param allow_mismatches:
if True, then all offsets on a :any:`Helix` where there is both a forward and reverse
:any:`Domain` will be included. Otherwise, only offsets where the :any:`Domain`'s have
complementary bases will be included.
:return:
dict mapping each helix_idx to a list of offsets on that helix where the base pairs are
"""
base_pairs = {}
for idx, helix in self.helices.items():
offsets = []
overlapping_domains = find_overlapping_domains_on_helix(helix)
for dom1, dom2 in overlapping_domains:
start, end = dom1.compute_overlap(dom2)
for offset in range(start, end):
if offset in dom1.deletions or offset in dom2.deletions:
continue
seq1 = dom1.dna_sequence_in(offset, offset)
seq2 = dom2.dna_sequence_in(offset, offset)
# we use reverse_complementary instead of base_complementary here to allow for insertions
# that may give a larger DNA sequence than length 1 at a given offset
if allow_mismatches or reverse_complementary(seq1, seq2, allow_wildcard=True, allow_none=True):
offsets.append(offset)
if len(offsets) > 0:
base_pairs[idx] = offsets
return base_pairs
@staticmethod
def assign_modifications_to_strands(
strands: list[Strand],
strand_jsons: list[dict],
mods_5p: dict[str, Modification5Prime],
mods_3p: dict[str, Modification3Prime],
mods_int: dict[str, ModificationInternal],
all_mods: dict[str, Modification],
) -> None:
if len(all_mods) > 0: # legacy code for when modifications were stored in a single dict
assert len(mods_5p) == 0 and len(mods_3p) == 0 and len(mods_int) == 0
legacy = True
elif len(mods_5p) > 0 or len(mods_3p) > 0 or len(mods_int) > 0:
assert len(all_mods) == 0
legacy = False
else: # no modifications
return
for strand, strand_json in zip(strands, strand_jsons):
if modification_5p_key in strand_json:
mod_code = strand_json[modification_5p_key]
strand.modification_5p = cast(Modification5Prime, all_mods[mod_code]) if legacy else mods_5p[mod_code]
if modification_3p_key in strand_json:
mod_code = strand_json[modification_3p_key]
strand.modification_3p = cast(Modification3Prime, all_mods[mod_code]) if legacy else mods_3p[mod_code]
if modifications_int_key in strand_json:
mod_names_by_offset = strand_json[modifications_int_key]
for offset_str, mod_code in mod_names_by_offset.items():
offset = int(offset_str)
strand.modifications_int[offset] = (
cast(ModificationInternal, all_mods[mod_code]) if legacy else mods_int[mod_code]
)
@staticmethod
def _cadnano_v2_import_find_5_end(
vstrands: VStrands, strand_type: str, helix_num: int, base_id: int, id_from: int, base_from: int
) -> tuple[int, int, bool]:
"""Routine which finds the 5' end of a strand in a cadnano v2 import. It returns the
helix and the base of the 5' end.
"""
id_from_before = helix_num # 'id' stands for helix id
base_from_before = base_id
circular_seen = {}
is_circular = False
while not (id_from == -1 and base_from == -1):
if (id_from, base_from) in circular_seen:
is_circular = True
break
circular_seen[(id_from, base_from)] = True
id_from_before = id_from
base_from_before = base_from
id_from, base_from, _, _ = vstrands[id_from][strand_type][base_from]
return id_from_before, base_from_before, is_circular
@staticmethod
def _cadnano_v2_import_find_strand_color(
vstrands: VStrands, strand_type: str, strand_5_end_base: int, strand_5_end_helix: int
) -> Color:
"""Routine that finds the color of a cadnano v2 strand."""
color: Color = default_cadnano_strand_color
if strand_type == "scaf":
return default_scaffold_color
if strand_type == "stap":
base_id: int
stap_color: int
for base_id, stap_color in vstrands[strand_5_end_helix]["stap_colors"]:
if base_id == strand_5_end_base:
color = Color.from_cadnano_v2_int_hex(stap_color)
break
return color
@staticmethod
def _cadnano_v2_import_extract_deletions(skip_table: dict[int, Any], start: int, end: int) -> list[int]:
"""Routines which converts cadnano skips to scadnano deletions"""
to_return: list[int] = []
for base_id in range(start, end):
if skip_table[base_id] == -1:
to_return.append(base_id)
return to_return
@staticmethod
def _cadnano_v2_import_extract_insertions(
loop_table: dict[int, Any], start: int, end: int
) -> list[tuple[int, int]]:
"""Routines which converts cadnano skips to scadnano insertions"""
to_return: list[tuple[int, int]] = []
for base_id in range(start, end):
if loop_table[base_id] != 0:
to_return.append((base_id, loop_table[base_id]))
return to_return
@staticmethod
def _cadnano_v2_import_explore_domains(
vstrands: VStrands,
seen: dict[tuple[int, int], bool],
strand_type: str,
strand_5_end_base: int,
strand_5_end_helix: int,
) -> list[Domain]:
"""Finds all domains of a cadnano v2 strand."""
curr_helix = strand_5_end_helix
curr_base = strand_5_end_base
domains: list[Domain] = []
direction_forward = (strand_type == "scaf" and curr_helix % 2 == 0) or (
strand_type == "stap" and curr_helix % 2 == 1
)
start, end = -1, -1
if direction_forward:
start = curr_base
else:
end = curr_base
circular_seen = {}
while not (curr_helix == -1 and curr_base == -1):
if (curr_helix, curr_base) in circular_seen:
break
circular_seen[(curr_helix, curr_base)] = True
old_helix = curr_helix
old_base = curr_base
seen[(curr_helix, curr_base)] = True
curr_helix, curr_base = vstrands[curr_helix][strand_type][curr_base][2:]
# Add crossover
# We have a crossover when we jump helix or we stay on the same helix but either:
# 1. the order of curr_base vs old_base is opposite the direction of the strand
# 2. or abs(curr_base-old_base) > 1 (this accounts for test_crossover_same_helix)
# 3. or the strand is circular strand
if curr_helix != old_helix or (
(not direction_forward and curr_base > old_base)
or (direction_forward and curr_base < old_base) # 1.
or (abs(curr_base - old_base) > 1) # 2.
or (curr_helix == strand_5_end_helix and curr_base == strand_5_end_base)
): # Â 3.
if direction_forward:
end = old_base
else:
start = old_base
domains.append(
Domain(
old_helix,
direction_forward,
min(start, end),
max(start, end) + 1,
deletions=Design._cadnano_v2_import_extract_deletions(vstrands[old_helix]["skip"], start, end),
insertions=Design._cadnano_v2_import_extract_insertions(
vstrands[old_helix]["loop"], start, end
),
)
)
direction_forward = (strand_type == "scaf" and curr_helix % 2 == 0) or (
strand_type == "stap" and curr_helix % 2 == 1
)
start, end = -1, -1
if direction_forward:
start = curr_base
else:
end = curr_base
return domains
@staticmethod
def _cadnano_v2_import_circular_strands_merge_first_last_domains(domains: list[Domain]) -> None:
"""When we create domains for circular strands in the cadnano import routine, we may end up
with a fake crossover if first and last domain are on same helix, we have to merge them
if it is the case.
"""
if domains[0].helix != domains[-1].helix:
return
domains[0].start = min(domains[0].start, domains[-1].start)
domains[0].end = max(domains[0].end, domains[-1].end)
del domains[-1]
@staticmethod
def _cadnano_v2_import_explore_strand(
vstrands: VStrands, strand_type: str, seen: dict[tuple[int, int], bool], helix_num: int, base_id: int
) -> Strand | None:
"""Routine that will follow a cadnano v2 strand accross helices and create
cadnano domains and strand accordingly.
"""
seen[(helix_num, base_id)] = True
id_from, base_from, id_to, base_to = vstrands[helix_num][strand_type][base_id]
if (id_from, base_from, id_to, base_to) == (-1, -1, -1, -1):
return None
strand_5_end_helix, strand_5_end_base, is_circular = Design._cadnano_v2_import_find_5_end(
vstrands, strand_type, helix_num, base_id, id_from, base_from
)
strand_color = Design._cadnano_v2_import_find_strand_color(
vstrands, strand_type, strand_5_end_base, strand_5_end_helix
)
domains: list[Domain] = Design._cadnano_v2_import_explore_domains(
vstrands, seen, strand_type, strand_5_end_base, strand_5_end_helix
)
# merge first and last domain if circular
if is_circular:
Design._cadnano_v2_import_circular_strands_merge_first_last_domains(domains)
domains_loopouts = cast(
list[Domain | Loopout | Extension], # noqa
domains,
) # type: ignore
strand: Strand = Strand(
domains=domains_loopouts, is_scaffold=(strand_type == "scaf"), color=strand_color, circular=is_circular
)
return strand
[docs]
@staticmethod
def from_cadnano_v2(directory: str = "", filename: str | None = None, json_dict: dict | None = None) -> "Design":
"""
Creates a Design from a cadnano v2 design. The design can either be specified as a filename
(assumed to be the a JSON file containing the cadnano design) or as a Python dictionary,
assumed to be the result of importing the JSON from the cadnano file.
Exactly one of `filename` or `json_dict` should be specified.
:param directory:
directory in which to look for `filename`; current directory by default.
Ignored if `json_dict` is specified.
:param filename:
name of file containing cadnano design. Mutually exclusive with `json_dict`.
:param json_dict:
cadnano design represented as a Python dict.
(assumed to be the result of json.load on a cadnano file)
:return:
An scadnano design equivalent to the specified cadnano design.
"""
if json_dict is not None and filename is None:
cadnano_v2_design = json_dict
elif json_dict is None and filename is not None:
file_path = os.path.join(directory, filename)
with open(file_path, "r") as f:
cadnano_v2_design = json.load(f)
else:
raise ValueError("exactly one of json_dict or filename should be None")
num_bases = len(cadnano_v2_design["vstrands"][0]["scaf"])
grid_type = Grid.square
if num_bases % 21 == 0:
grid_type = Grid.honeycomb
min_row, min_col = None, None
for cadnano_helix in cadnano_v2_design["vstrands"]:
col, row = cadnano_helix["col"], cadnano_helix["row"]
min_row = row if min_row is None else min_row
min_col = col if min_col is None else min_col
min_row = row if row < min_row else min_row
min_col = col if col < min_col else min_col
helices = OrderedDict({})
for cadnano_helix in cadnano_v2_design["vstrands"]:
col, row = cadnano_helix["col"], cadnano_helix["row"]
num = cadnano_helix["num"]
helix = Helix(idx=num, max_offset=num_bases, grid_position=(col, row))
helices[num] = helix
# We do a DFS on strands
seen: dict[str, dict] = {"scaf": {}, "stap": {}}
strands: list[Strand] = []
cadnano_helices = OrderedDict({})
for cadnano_helix in cadnano_v2_design["vstrands"]:
helix_num = cadnano_helix["num"]
cadnano_helices[helix_num] = cadnano_helix
for cadnano_helix in cadnano_v2_design["vstrands"]:
helix_num = cadnano_helix["num"]
for strand_type in ["scaf", "stap"]:
for base_id in range(num_bases):
if (helix_num, base_id) in seen[strand_type]:
continue
strand = Design._cadnano_v2_import_explore_strand(
cadnano_helices, strand_type, seen[strand_type], helix_num, base_id
)
if strand is not None:
strands.append(strand)
design: Design = Design(grid=grid_type, helices=helices, strands=strands)
# DD: Tristan, I commented this out because I think it's unnecessary given the way the Design
# constructor works, and because I'm now implementing this feature:
# https://github.com/UC-Davis-molecular-computing/scadnano-python-package/issues/121
# which means we may not have a well-defined helices_view_order on the whole design if groups
# are used
# TS: Dave, I have thorougly checked the code of Design constructor and the order of the helices
# IS lost even if the helices were give as a list.
# Indeed, you very early call `_normalize_helices_as_dict` in the constructor the order is lost.
# Later in the code, if no view order was given the code will choose the identity
# in function `_check_helices_view_order_and_return`.
# Conclusion: do not assume that your constructor code deals with the ordering, even if
# input helices is a list. I am un commenting the below:
design.set_helices_view_order([num for num in helices])
return design
[docs]
def plate_maps(
self,
warn_duplicate_strand_names: bool = True,
plate_type: PlateType = PlateType.wells96,
strands: Iterable[Strand] | None = None,
) -> list[PlateMap]:
"""
Returns a list of :any:`PlateMap`'s from this :any:`Design`. Each :any:`PlateMap` can be
exported to a string, in Markdown format by default, by calling :meth:`PlateMap.to_table`,
generating a string such as this:
.. code-block:: none
plate "5 monomer synthesis"
| | 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | 10 | 11 | 12 |
|-----|------|--------|--------|------|----------|-----|-----|-----|-----|------|------|------|
| A | mon0 | mon0_F | | adp0 | | | | | | | | |
| B | mon1 | mon1_Q | mon1_F | adp1 | adp_sst1 | | | | | | | |
| C | mon2 | mon2_F | mon2_Q | adp2 | adp_sst2 | | | | | | | |
| D | mon3 | mon3_Q | mon3_F | adp3 | adp_sst3 | | | | | | | |
| E | mon4 | | mon4_Q | adp4 | adp_sst4 | | | | | | | |
| F | | | | adp5 | | | | | | | | |
| G | | | | | | | | | | | | |
| H | | | | | | | | | | | | |
See the documentation for :meth:`PlateMap.to_table` for more information on configuring the
returned string format.
All :any:`Strand`'s in the design that have a field :data:`Strand.vendor_fields` with
:data:`Strand.vendor_fields.plate` specified are included in some returned :any:`PlateMap`.
The number of :any:`PlateMap`'s in the returned list is equal to the number of different plate names
specified across all :any:`Strand`'s in the design.
If parameter `strands` is given, then a subset of strands is included. This is useful for
specifying a mix of strands for a particular experiment, which come from a plate but does not
include every strand in the plate.
:param warn_duplicate_strand_names:
If True, prints a warning to the screen if multiple :any:`Strand`'s exist with the same value
for :data:`Strand.name`.
:param plate_type:
Type of plate: 96 or 384 well.
:param strands:
If specified, only the :any:`Strand`'s in `strands` are put in the :any:`PlateMap`.
:return:
list of :any:`PlateMap`'s for :any:`Strand`'s in this design with IDT plates specified;
length of list is equal to number of unique plate names among all :any:`Strand`'s in this design
"""
if strands is None:
strands = self.strands
strand_names_to_plate_and_well = {}
plate_names_to_strands = defaultdict(list)
for strand in strands:
if strand.vendor_fields is not None and strand.vendor_fields.plate is not None:
plate_names_to_strands[strand.vendor_fields.plate].append(strand)
if strand.name is not None and strand.name in strand_names_to_plate_and_well:
if warn_duplicate_strand_names:
print(f"WARNING: found duplicate instance of strand with name {strand.name}")
plate, well = strand_names_to_plate_and_well[strand.name]
if strand.vendor_fields.plate != plate:
raise ValueError(
f"two strands with name {strand.name} exist but have different "
f'IDT plates "{plate}" and "{strand.vendor_fields.plate}"'
"duplicate strands with the same name are allowed, "
"but they must have the same IDT plate and well"
)
if strand.vendor_fields.well != well:
raise ValueError(
f"two strands with name {strand.name} exist but have different "
f'IDT wells "{well}" and "{strand.vendor_fields.well}"'
"duplicate strands with the same name are allowed, "
"but they must have the same IDT plate and well"
)
else:
strand_names_to_plate_and_well[strand.name] = (
strand.vendor_fields.plate,
strand.vendor_fields.well,
)
plate_maps = [
_plate_map(name, strands_in_plate, plate_type) for name, strands_in_plate in plate_names_to_strands.items()
]
return plate_maps
[docs]
def modifications(self, mod_type: ModificationType | None = None) -> set[Modification]:
"""
Returns either set of all modifications in this :any:`Design`, or set of all modifications
of a given type (5', 3', or internal).
:param mod_type:
type of modifications (5', 3', or internal); if not specified, all three types are returned
:return:
Set of all modifications in this :any:`Design` (possibly of a given type).
"""
if mod_type is None:
mods_5p = {strand.modification_5p for strand in self.strands if strand.modification_5p is not None}
mods_3p = {strand.modification_3p for strand in self.strands if strand.modification_3p is not None}
mods_int = {mod for strand in self.strands for mod in strand.modifications_int.values()}
all_mods = mods_5p | mods_3p | mods_int
elif mod_type is ModificationType.five_prime:
all_mods = {strand.modification_5p for strand in self.strands if strand.modification_5p is not None}
elif mod_type is ModificationType.three_prime:
all_mods = {strand.modification_3p for strand in self.strands if strand.modification_3p is not None}
elif mod_type is ModificationType.internal:
all_mods = {mod for strand in self.strands for mod in strand.modifications_int.values()}
else:
raise AssertionError("should be unreachable")
self._ensure_mods_have_unique_vendor_codes(all_mods)
return all_mods
@staticmethod
def _ensure_mods_have_unique_vendor_codes(all_mods: set[Modification]) -> None:
mods_dict = {}
for mod in all_mods:
if mod.vendor_code not in mods_dict:
mods_dict[mod.vendor_code] = mod
else:
other_mod = mods_dict[mod.vendor_code]
raise IllegalDesignError(
f"two different modifications share the vendor code "
f"{mod.vendor_code}; "
f"one is\n {mod}\nand the other is\n {other_mod}"
)
[docs]
def draw_strand(self, helix: int, offset: int) -> StrandBuilder:
"""Used for chained method building the :any:`Strand` domain by domain, in order from 5' to 3'.
For example
.. code-block:: Python
design.draw_strand(0, 7).to(10).cross(1).to(5).cross(2).to(15)
This creates a :any:`Strand` in this :any:`Design` equivalent to
.. code-block:: Python
design.add_strand(Strand([
sc.Domain(0, True, 7, 10),
sc.Domain(1, False, 5, 10),
sc.Domain(2, True, 5, 15),
]))
Loopouts can also be included:
.. code-block:: Python
design.draw_strand(0, 7).to(10).cross(1).to(5).loopout(2, 3).to(15)
This creates a :any:`Strand` in this :any:`Design` equivalent to
.. code-block:: Python
design.add_strand(Strand([
sc.Domain(0, True, 7, 10),
sc.Domain(1, False, 5, 10),
sc.Loopout(3),
sc.Domain(2, True, 5, 15),
]))
Each call to
:py:meth:`Design.draw_strand`,
:py:meth:`StrandBuilder.cross`,
:py:meth:`StrandBuilder.loopout`,
:py:meth:`StrandBuilder.to`
:py:meth:`StrandBuilder.move`
:py:meth:`StrandBuilder.update_to`,
returns a :any:`StrandBuilder` object.
Each call to
:py:meth:`StrandBuilder.to`,
:py:meth:`StrandBuilder.move`,
:py:meth:`StrandBuilder.update_to`,
or
:py:meth:`StrandBuilder.loopout`
modifies the :any:`Design` by replacing the Strand with an updated version.
See the documentation for :any:`StrandBuilder` for the methods available to call in this way.
:param helix: starting :any:`Helix`
:param offset: starting offset on `helix`
:return: :any:`StrandBuilder` object representing the partially completed :any:`Strand`
"""
return StrandBuilder(self, helix, offset)
[docs]
def strand(self, helix: int, offset: int) -> StrandBuilder:
"""
Same functionality as :meth:`Design.draw_strand`.
.. deprecated:: 0.17.2
Use :meth:`Design.draw_strand` instead, which is a better name.
This method will be removed in a future version.
"""
print(
"WARNING: The method Design.strand is deprecated. Use Design.draw_strand instead, "
"which has the same functionality. Design.strand will be removed in a future version."
)
return self.draw_strand(helix, offset)
[docs]
def assign_m13_to_scaffold(self, rotation: int = 5587, variant: M13Variant = M13Variant.p7249) -> None:
"""Assigns the scaffold to be the sequence of M13: :py:func:`m13` with the given `rotation`
and :any:`M13Variant`.
Raises :any:`IllegalDesignError` if the number of scaffolds is not exactly 1.
:param rotation:
rotation of M13 to use. See :meth:`m13` for explanation.
:param variant:
which variant of M13 to use. See :any:`M13Variant`.
"""
scaffold = None
num_scafs = 0
for strand in self.strands:
if strand.is_scaffold:
num_scafs += 1
if scaffold is None:
scaffold = strand
if num_scafs == 0:
raise IllegalDesignError(
"Tried to assign DNA to scaffold, but there is no scaffold strand.\n"
"You must set strand.is_scaffold to True for exactly one strand."
)
elif num_scafs > 1:
raise IllegalDesignError(
"Tried to assign DNA to scaffold, but there are multiple scaffold strands.\n"
"You must set strand.is_scaffold to True for exactly one strand."
)
if scaffold is None:
raise AssertionError("we counted; there is exactly one scaffold")
self.assign_dna(scaffold, m13(rotation, variant))
@staticmethod
def _get_multiple_of_x_sup_closest_to_y(x: int, y: int) -> int:
return y if y % x == 0 else y + (x - y % x)
@staticmethod
def _cadnano_v2_place_strand_segment(helix_dct: dict[str, Any], domain: Domain, strand_type: str = "scaf") -> None:
"""Converts a strand region with no crossover to cadnano v2."""
# Insertions and deletions
for deletion in domain.deletions:
helix_dct["skip"][deletion] = -1
for loop_where, loop_nb in domain.insertions:
helix_dct["loop"][loop_where] = loop_nb
start, end, forward = domain.start, domain.end, domain.forward
strand_helix = helix_dct["num"]
for i_base in range(start, end):
if forward:
from_helix, from_base = strand_helix, i_base - 1
to_helix, to_base = strand_helix, i_base + 1
else:
from_helix, from_base = strand_helix, i_base + 1
to_helix, to_base = strand_helix, i_base - 1
if i_base == start:
if forward:
helix_dct[strand_type][i_base][2:] = [to_helix, to_base]
else:
helix_dct[strand_type][i_base][:2] = [from_helix, from_base]
elif i_base < end - 1:
helix_dct[strand_type][i_base] = [from_helix, from_base, to_helix, to_base]
else:
if forward:
helix_dct[strand_type][i_base][:2] = [from_helix, from_base]
else:
helix_dct[strand_type][i_base][2:] = [to_helix, to_base]
return
@staticmethod
def _cadnano_v2_place_crossover(
helix_from_dct: dict[str, Any],
helix_to_dct: dict[str, Any],
domain_from: Domain,
domain_to: Domain,
strand_type: str = "scaf",
) -> None:
"""Converts a crossover to cadnano v2 format.
Returns a conversion table from ids in the structure self.helices to helices ids
as given by helix.idx.
"""
helix_from = helix_from_dct["num"]
start_from, end_from, forward_from = domain_from.start, domain_from.end, domain_from.forward
helix_to = helix_to_dct["num"]
start_to, end_to, forward_to = domain_to.start, domain_to.end, domain_to.forward
# Because of paranemic crossovers it is possible
# to crossover to a strand that goes in the same direction
# In total there are four cases corresponding to
# [forward_from, not forward_from] x [forward_to, not forward_to]
if forward_from and not forward_to:
helix_from_dct[strand_type][end_from - 1][2:] = [helix_to, end_to - 1]
helix_to_dct[strand_type][end_to - 1][:2] = [helix_from, end_from - 1]
elif not forward_from and forward_to:
helix_from_dct[strand_type][start_from][2:] = [helix_to, start_to]
helix_to_dct[strand_type][start_to][:2] = [helix_from, start_from]
elif forward_from and forward_to:
helix_from_dct[strand_type][end_from - 1][2:] = [helix_to, start_to]
helix_to_dct[strand_type][end_to - 1][:2] = [helix_from, start_from]
elif not forward_from and not forward_to:
helix_from_dct[strand_type][start_from][2:] = [helix_to, end_to - 1]
helix_to_dct[strand_type][start_to][:2] = [helix_from, end_from - 1]
@staticmethod
def _cadnano_v2_color_of_stap(color: Color, domain: Domain) -> list[int]:
base_id = domain.start if domain.forward else domain.end - 1
cadnano_color = color.to_cadnano_v2_int_hex()
return [base_id, cadnano_color]
def _cadnano_v2_place_strand(self, strand: Strand, dct: dict, helices_ids_reverse: dict[int, int]) -> None:
"""Place a scadnano strand in cadnano v2."""
strand_type = "stap"
if hasattr(strand, is_scaffold_key) and strand.is_scaffold:
strand_type = "scaf"
for i, domain in enumerate(strand.domains):
if isinstance(domain, Loopout):
raise ValueError(f"cannot convert Strand {strand} to cadnanov2 format, since it has Loopouts")
which_helix_id = helices_ids_reverse[domain.helix]
which_helix = dct["vstrands"][which_helix_id]
if strand_type == "stap":
color = strand.color if strand.color is not None else Color(0, 0, 0)
which_helix["stap_colors"].append(self._cadnano_v2_color_of_stap(color, domain))
self._cadnano_v2_place_strand_segment(which_helix, domain, strand_type)
if i != len(strand.domains) - 1:
next_domain = strand.domains[i + 1]
if isinstance(next_domain, Loopout):
raise ValueError(f"cannot convert Strand {strand} to cadnanov2 format, since it has Loopouts")
next_helix_id = helices_ids_reverse[next_domain.helix]
next_helix = dct["vstrands"][next_helix_id]
self._cadnano_v2_place_crossover(which_helix, next_helix, domain, next_domain, strand_type)
# if the strand is circular, we need to close the loop
if strand.circular:
first_domain = strand.first_bound_domain()
first_helix = dct["vstrands"][first_domain.helix]
first_start, first_end, first_forward = first_domain.start, first_domain.end, first_domain.forward
last_domain = strand.last_bound_domain()
last_helix = dct["vstrands"][last_domain.helix]
last_start, last_end, last_forward = last_domain.start, last_domain.end, last_domain.forward
the_base_from = last_end - 1
the_base_to = first_start
if not last_forward:
the_base_from = last_start
if not first_forward:
the_base_to = first_end - 1
if first_helix[strand_type][the_base_to][:2] == [-1, -1]:
first_helix[strand_type][the_base_to][:2] = [last_helix["num"], the_base_from]
else:
first_helix[strand_type][the_base_to][2:] = [last_helix["num"], the_base_from]
if last_helix[strand_type][the_base_from][:2] == [-1, -1]:
last_helix[strand_type][the_base_from][:2] = [first_helix["num"], the_base_to]
else:
last_helix[strand_type][the_base_from][2:] = [first_helix["num"], the_base_to]
def _cadnano_v2_fill_blank(self, dct: dict, num_bases: int, design_grid: Grid) -> dict[int, int]:
"""Creates blank cadnanov2 helices in and initialized all their fields."""
helices_ids_reverse = {}
i = 0
for _, helix in self.helices.items():
helix_dct: dict[str, Any] = OrderedDict()
helix_dct["num"] = helix.idx
if design_grid == Grid.square or design_grid == Grid.honeycomb:
assert helix.grid_position is not None
helix_dct["row"] = helix.grid_position[1]
helix_dct["col"] = helix.grid_position[0]
helix_dct["scaf"] = []
helix_dct["stap"] = []
helix_dct["loop"] = []
helix_dct["skip"] = []
for _ in range(num_bases):
helix_dct["scaf"].append([-1, -1, -1, -1])
helix_dct["stap"].append([-1, -1, -1, -1])
helix_dct["loop"].append(0)
helix_dct["skip"].append(0)
helix_dct["stap_colors"] = []
helix_dct["scafLoop"] = []
helix_dct["stapLoop"] = []
helices_ids_reverse[helix_dct["num"]] = i
dct["vstrands"].append(helix_dct)
i += 1
return helices_ids_reverse
[docs]
def to_cadnano_v2_serializable(self, name: str = "") -> dict[str, Any]:
"""Converts the design to a JSON-serializable Python object (a dict) representing
the cadnano v2 format. Calling json.dumps on this object will result in a string representing
the cadnano c2 format; this is essentially what is done in
:meth:`Design.to_cadnano_v2_json`.
Please see the spec
https://github.com/UC-Davis-molecular-computing/scadnano-python-package/blob/main/misc/cadnano-format-specs/v2.txt
for more info on that format.
:param name:
Name of the design.
:return:
a Python dict representing the cadnano v2 format for this :any:`Design`
"""
dct: dict[str, Any] = OrderedDict()
if name != "":
dct["name"] = name
dct["vstrands"] = []
"""Check if helix group are used or if only one grid is used"""
if self._has_default_groups():
design_grid = self.grid
else:
grid_used = {}
assert len(self.groups) > 0
grid_type = Grid.none
for group_name in self.groups:
grid_used[self.groups[group_name].grid] = True
grid_type = self.groups[group_name].grid
if len(grid_used) > 1:
raise ValueError(
"Designs using helix groups can be exported to cadnano v2 \
only if all groups share the same grid type."
)
else:
design_grid = grid_type
"""Figuring out the type of grid.
In cadnano v2, all helices have the same max offset
called `num_bases` and the type of grid is determined as follows:
if num_bases % 32 == 0: then we are on grid square
if num_bases % 21 == 0: then we are on grid honey
"""
num_bases = 0
for helix in self.helices.values():
if helix.max_offset is None:
raise ValueError("must have helix.max_offset set")
num_bases = max(num_bases, helix.max_offset)
if design_grid == Grid.square:
num_bases = self._get_multiple_of_x_sup_closest_to_y(32, num_bases)
elif design_grid == Grid.honeycomb:
num_bases = self._get_multiple_of_x_sup_closest_to_y(21, num_bases)
else:
raise NotImplementedError("We can export to cadnano v2 `square` and `honeycomb` grids only.")
"""Figuring out if helices numbers have good parity.
In cadnano v2, only even helices have the scaffold go forward, only odd helices
have the scaffold go backward.
"""
for strand in self.strands:
for domain in strand.domains:
if isinstance(domain, Extension):
raise ValueError("We cannot handle designs with Extensions as it is not a cadnano v2 concept")
if isinstance(domain, Loopout):
raise ValueError("We cannot handle designs with Loopouts as it is not a cadnano v2 concept")
right_direction: bool
if hasattr(strand, is_scaffold_key) and strand.is_scaffold:
right_direction = domain.helix % 2 == int(not domain.forward)
else:
right_direction = not (domain.helix % 2 == int(not domain.forward))
if not right_direction:
raise ValueError(
"We can only convert designs where even helices have the scaffold"
"going forward and odd helices have the scaffold going backward see "
f"the spec v2.txt Note 4. {domain}"
)
"""Filling the helices with blank.
"""
helices_ids_reverse = self._cadnano_v2_fill_blank(dct, num_bases, design_grid)
"""Putting the scaffold in place.
"""
for strand in self.strands:
self._cadnano_v2_place_strand(strand, dct, helices_ids_reverse)
return dct
[docs]
def to_cadnano_v2_json(self, name: str = "", whitespace: bool = True) -> str:
"""Converts the design to the cadnano v2 format.
Please see the spec
https://github.com/UC-Davis-molecular-computing/scadnano-python-package/blob/main/misc/cadnano-format-specs/v2.txt
for more info on that format.
If the cadnano file is intended to be used with CanDo (https://cando-dna-origami.org/),
the optional parameter `whitespace` must be set to False.
:param name:
Name of the design.
:param whitespace:
Whether to include whitespace in the exported file. Set to False to use this with CanDo
(https://cando-dna-origami.org/), since that tool generates an error if the cadnano file
contains whitespace.
:return:
a string in the cadnano v2 format representing this :any:`Design`
"""
content_serializable = self.to_cadnano_v2_serializable(name)
encoder = _SuppressableIndentEncoder
content = json.dumps(content_serializable, cls=encoder, indent=2)
if not whitespace:
# remove whitespace
content = "".join(content.split())
return content
[docs]
def set_helices_view_order(self, helices_view_order: list[int]) -> None:
"""
Sets helices_view_order.
:param helices_view_order: new view order of helices
"""
if not self._has_default_groups():
raise ValueError("cannot call set_helices_view_order on a Design that uses HelixGroups")
group = self._default_group()
group.helices_view_order = helices_view_order
_check_helices_view_order_is_bijection(helices_view_order, self.helices_idxs_in_group(default_group_name))
def _default_group(self) -> HelixGroup:
if not self._has_default_groups():
raise ValueError("cannot call _default_group on a Design that uses HelixGroups")
groups_list = list(self.groups.values())
return groups_list[0]
def _set_helices_grid_positions_or_positions(self) -> None:
for name, group in self.groups.items():
for idx in self.helices_idxs_in_group(name):
helix = self.helices[idx]
if group.grid != Grid.none and helix.grid_position is None:
helix.grid_position = (0, group.helices_view_order_inverse(idx))
elif group.grid == Grid.none and helix.position is None:
y_delta = self.geometry.distance_between_helices()
y = y_delta * group.helices_view_order_inverse(idx)
helix.position = Position3D(x=0, y=y, z=0)
def _set_helices_min_max_offsets(self, update: bool) -> None:
"""update = whether to overwrite existing Helix.max_offset and Helix.min_offset.
Don't do this when Design is first created, but do it later when updating."""
for helix in self.helices.values():
if update or helix.max_offset is None:
max_offset = None if len(helix.domains) == 0 else helix.domains[0].end
for domain in helix.domains:
max_offset = max(max_offset, domain.end)
helix.max_offset = max_offset
if update or helix.min_offset is None:
min_offset = None if len(helix.domains) == 0 else helix.domains[0].start
for domain in helix.domains:
min_offset = min(min_offset, domain.start)
if min_offset is None or min_offset > 0:
min_offset = 0
helix.min_offset = min_offset
[docs]
def strands_starting_on_helix(self, helix: int) -> list[Strand]:
"""Return list of :any:`Strand`'s that begin (have their 5' end)
on the :any:`Helix` with index `helix`."""
return [
strand
for strand in self.strands
if isinstance(strand.domains[0], Domain) and strand.domains[0].helix == helix
]
[docs]
def strands_ending_on_helix(self, helix: int) -> list[Strand]:
"""Return list of :any:`Strand`'s that finish (have their 3' end)
on the :any:`Helix` with index `helix`."""
return [
strand
for strand in self.strands
if isinstance(strand.domains[-1], Domain) and strand.domains[-1].helix == helix
]
def _check_legal_design(self, warn_duplicate_strand_names: bool = True) -> None:
self._check_types()
self._check_helix_offsets()
self._check_strands_reference_helices_legally()
self._check_loopouts_not_consecutive_or_singletons_or_zero_length()
self._check_loopouts_not_first_or_last_substrand()
self._check_strands_overlap_legally()
if warn_duplicate_strand_names:
self._warn_if_strand_names_not_unique()
def _check_types(self) -> None:
# Check that type of objects are what we expect. Added this after a nasty bug when I accidentally
# inserted a dsd.Domain object into a scadnano.Strand.domains list. mypy didn't catch the
# type error because they have the same name (even though different packages!). So let's not
# completely trust mypy.
_check_type(self.geometry, Geometry)
_check_type(self.helices, dict)
_check_type(self.strands, list)
for idx, helix in self.helices.items():
_check_type(idx, int)
_check_type(helix, Helix)
for strand in self.strands:
_check_type(strand, Strand)
for substrand in strand.domains:
_check_type_is_one_of(substrand, [Domain, Loopout, Extension])
if isinstance(substrand, Domain):
_check_type(substrand.helix, int)
_check_type(substrand.forward, bool)
_check_type(substrand.start, int)
_check_type(substrand.end, int)
elif isinstance(substrand, Loopout):
_check_type(substrand.length, int)
# TODO: add checks for optional fields
# TODO: come up with reasonable default behavior when no strands are on helix and max_offset not given
def _check_helix_offsets(self) -> None:
for helix in self.helices.values():
if helix.min_offset is not None and helix.max_offset is not None and helix.min_offset >= helix.max_offset:
err_msg = (
f"for helix {helix.idx}, "
f"helix.min_offset = {helix.min_offset} must be strictly less than "
f"helix.max_offset = {helix.max_offset}"
)
raise IllegalDesignError(err_msg)
def _check_strands_overlap_legally(self, domain_to_check: Domain | None = None) -> None:
"""If `Domain_to_check` is None, check all.
Otherwise only check pairs where one is domain_to_check."""
def err_msg(d1: Domain, d2: Domain, h_idx: int) -> str:
return (
f"two domains overlap on helix {h_idx}: "
f"\n{d1} on strand {d1.strand()}\n and\n{d2} on strand {d2.strand()}\n but have the same direction"
)
# ensure that if two strands overlap on the same helix,
# they point in opposite directions
for helix_idx, domains in enumerate(helix.domains for helix in self.helices.values()):
if domain_to_check is not None and domain_to_check.helix != helix_idx:
# TODO: if necessary, we can be more efficient by only checking this one domain
continue
if len(domains) == 0:
continue
# check all consecutive domains on the same helix, sorted by start/end indices
offsets_data = []
for domain in domains:
offsets_data.append((domain.start, True, domain))
offsets_data.append((domain.end, False, domain))
offsets_data.sort(key=lambda offset_data: offset_data[0])
current_domains: list[Domain] = []
for offset, is_start, domain in offsets_data:
if is_start:
if len(current_domains) >= 2:
if offset >= current_domains[1].end:
del current_domains[1]
if len(current_domains) >= 1:
if offset >= current_domains[0].end:
del current_domains[0]
current_domains.append(domain)
if len(current_domains) > 2:
domain0, domain1, domain2 = current_domains[0:3]
for d_first, d_second in [(domain0, domain1), (domain1, domain2), (domain0, domain2)]:
if d_first.forward == d_second.forward:
raise IllegalDesignError(err_msg(d_first, d_second, helix_idx))
raise AssertionError(
f"since current_domains = {current_domains} has at least three domains, "
f"I expected to find a pair of illegally overlapping domains"
)
elif len(current_domains) == 2:
d_first, d_second = current_domains
if d_first.forward == d_second.forward:
raise IllegalDesignError(err_msg(d_first, d_second, helix_idx))
def _check_loopouts_not_consecutive_or_singletons_or_zero_length(self) -> None:
for strand in self.strands:
Design._check_loopout_not_singleton(strand)
Design._check_two_consecutive_loopouts(strand)
Design._check_loopouts_length(strand)
def _check_loopouts_not_first_or_last_substrand(self) -> None:
for strand in self.strands:
if isinstance(strand.first_domain(), Loopout):
raise StrandError(strand, "strand cannot have a Loopout as its first domain")
if isinstance(strand.last_domain(), Loopout):
raise StrandError(strand, "strand cannot have a Loopout as its last domain")
@staticmethod
def _check_loopout_not_singleton(strand: Strand) -> None:
if len(strand.domains) == 1 and isinstance(strand.first_domain(), Loopout):
raise StrandError(strand, "strand cannot have a single Loopout as its only domain")
@staticmethod
def _check_two_consecutive_loopouts(strand: Strand) -> None:
for domain1, domain2 in _pairwise(strand.domains):
if isinstance(domain1, Loopout) and isinstance(domain2, Loopout):
raise StrandError(strand, "cannot have two consecutive Loopouts in a strand")
@staticmethod
def _check_loopouts_length(strand: Strand) -> None:
for loopout in strand.domains:
if isinstance(loopout, Loopout) and loopout.length <= 0:
raise StrandError(strand, f"loopout length must be positive but is {loopout.length}")
def _check_strands_reference_helices_legally(self) -> None:
# ensure each strand refers to an existing helix
for strand in self.strands:
self._check_strand_references_legal_helices(strand)
self._check_strand_has_legal_offsets_in_helices(strand)
def _check_strand_references_legal_helices(self, strand: Strand) -> None:
for domain in strand.domains:
if isinstance(domain, Domain) and domain.helix not in self.helices:
err_msg = (
f"domain {domain} refers to nonexistent Helix index {domain.helix}; "
f"here is the list of valid helices: {self._helices_to_string()}"
)
raise StrandError(strand, err_msg)
def _check_strand_has_legal_offsets_in_helices(self, strand: Strand) -> None:
for domain in strand.domains:
if isinstance(domain, Domain):
helix = self.helices[domain.helix]
if helix.min_offset is not None and domain.start < helix.min_offset:
err_msg = (
f"domain {domain} on strand {domain.strand()} "
f"has start offset {domain.start}, "
f"beyond the end of "
f"Helix {domain.helix} that has min_offset = {helix.min_offset}"
)
raise StrandError(strand, err_msg)
if helix.max_offset is not None and domain.end > helix.max_offset:
err_msg = (
f"domain {domain} on strand {domain.strand()} "
f"has end offset {domain.end}, "
f"beyond the end of "
f"Helix {domain.helix} that has max_offset = {helix.max_offset}"
)
raise StrandError(strand, err_msg)
# ensure helix_idx's are never negative twice in a row
for domain1, domain2 in _pairwise(strand.domains):
if isinstance(domain1, Loopout) and isinstance(domain2, Loopout):
err_msg = (
f"Loopouts {domain1} and {domain2} are consecutive on strand {strand}. "
f"At least one of any consecutive pair must be a Domain, not a Loopout."
)
raise StrandError(strand, err_msg)
def set_helix_idx(self, old_idx: int, new_idx: int) -> None:
if new_idx in self.helices:
raise IllegalDesignError(
f"cannot assign idx {new_idx} to helix {old_idx}; another helix already has that index"
)
helix: Helix = self.helices[old_idx]
del self.helices[old_idx]
self.helices[new_idx] = helix
helix.idx = new_idx
for domain in helix.domains:
domain.helix = new_idx
[docs]
def domain_at(self, helix: int, offset: int, forward: bool) -> Domain | None:
"""
Return :any:`Domain` that overlaps `offset` on helix with idx `helix` and has
:py:data:`Domain.forward` = ``True``, or ``None`` if there is no such :any:`Domain`.
:param helix: TODO
:param offset: TODO
:param forward: TODO
:return: TODO
"""
for domain in self.domains_at(helix, offset):
if domain.forward == forward:
return domain
return None
[docs]
def domains_at(self, helix: int, offset: int) -> list[Domain]:
"""Return list of :any:`Domain`'s that overlap `offset` on helix with idx `helix`.
If constructed properly, this list should have 0, 1, or 2 elements."""
domains_on_helix = self.helices[helix].domains
# TODO: replace this with a faster algorithm using binary search
domains_on_helix = [domain for domain in domains_on_helix if domain.contains_offset(offset)]
if len(domains_on_helix) not in [0, 1, 2]:
raise AssertionError(
f"There should be at most 2 domains on helix {helix}, "
f"but there are {len(domains_on_helix)}:\n{domains_on_helix}"
)
return domains_on_helix
# TODO: add_strand and insert_domain should check for existing deletions/insertion parallel strands
[docs]
def add_strand(self, strand: Strand) -> None:
"""Add `strand` to this design."""
self._check_strand_references_legal_helices(strand)
self.strands.append(strand)
for domain in strand.domains:
if isinstance(domain, Domain):
self.helices[domain.helix].domains.append(domain)
self._check_strands_overlap_legally(domain_to_check=domain)
if self.automatically_assign_color:
self._assign_color_to_strand(strand)
[docs]
def remove_strand(self, strand: Strand) -> None:
"""Remove `strand` from this design."""
self.strands.remove(strand)
for domain in strand.domains:
if isinstance(domain, Domain):
self.helices[domain.helix].domains.remove(domain)
[docs]
def append_domain(self, strand: Strand, domain: Domain | Loopout | Extension) -> None:
"""
Same as :any:`Design.insert_domain`, but inserts at end.
:param strand: strand to append `domain` to
:param domain: :any:`Domain` or :any:`Loopout` to append to :any:`Strand`
"""
self.insert_domain(strand, len(strand.domains), domain)
[docs]
def insert_domain(self, strand: Strand, order: int, domain: Domain | Loopout | Extension) -> None:
"""Insert `Domain` into `strand` at index given by `order`. Uses same indexing as Python lists,
e.g., ``design.insert_domain(strand, domain, 0)``
inserts ``domain`` as the new first :any:`Domain`."""
if isinstance(domain, Domain) and domain.helix not in self.helices:
err_msg = (
f"domain {domain} refers to nonexistent Helix index {domain.helix}; "
f"here is the list of valid helices: {self._helices_to_string()}"
)
raise StrandError(strand, err_msg)
assert strand in self.strands
strand.insert_domain(order, domain)
self._check_strand_references_legal_helices(strand)
self._check_loopouts_not_consecutive_or_singletons_or_zero_length()
if isinstance(domain, Domain):
domains_on_helix = self.helices[domain.helix].domains
if len(domains_on_helix) == 0:
domains_on_helix.append(domain)
else:
i = 0
while i < len(domains_on_helix) and (domains_on_helix[i].start, domains_on_helix[i].forward) < (
domain.start,
domain.forward,
):
i += 1
domains_on_helix.insert(i, domain)
# self.helices[domain.helix].domains.append(domain)
self._check_strands_overlap_legally(domain_to_check=domain)
[docs]
def remove_domain(self, strand: Strand, domain: Domain | Loopout | Extension) -> None:
"""Remove `domain` (a :any:`Domain`, :any:`Loopout`, or :any:`Extension`) from `strand`."""
assert strand in self.strands
strand.remove_domain(domain)
if isinstance(domain, Domain):
self.helices[domain.helix].domains.remove(domain)
def _build_domains_on_helix_lists(self) -> None:
for helix in self.helices.values():
helix._domains = []
for strand in self.strands:
for domain in strand.domains:
if isinstance(domain, Domain):
if domain.helix in self.helices:
self.helices[domain.helix].domains.append(domain)
else:
msg = (
f"domain's helix is {domain.helix} but no helix has that index; here "
f"is the list of helix indices: {self._helices_to_string()}"
)
raise StrandError(strand=strand, the_cause=msg)
def _helices_to_string(self) -> str:
return ", ".join(map(str, self.helices.keys()))
# @_docstring_parameter was used to substitute sc in for the filename extension, but it is
# incompatible with .. code-block:: and caused a very strange and hard-to-determine error,
# so I removed it.
# @_docstring_parameter(default_extension=default_scadnano_file_extension)
[docs]
def to_json(self, suppress_indent: bool = True) -> str:
"""Return string representing this Design, suitable for reading by scadnano if written to
a JSON file ending in extension :attr:`default_scadnano_file_extension`.
:param suppress_indent: whether to suppress indenting JSON for "small" objects such as short lists,
e.g., grid coordinates. If True, something like this will be written:
.. code-block:: JSON
{
"grid_position": [1, 2]
}
instead of this:
.. code-block:: JSON
{
"grid_position": [
1,
2
]
}
"""
return _json_encode(self, suppress_indent)
# TODO: create version of add_deletion and add_insertion that simply changes the major tick distance
# on the helix at that position, as well as updating the end offset of the domain (and subsequent
# domains on the same helix)
[docs]
def add_deletion(self, helix: int, offset: int) -> None:
"""Adds a deletion to every :class:`scadnano.Strand` at the given helix and base offset."""
domains = self.domains_at(helix, offset)
if len(domains) == 0:
raise IllegalDesignError(f"no domains are at helix {helix} offset {offset}")
for domain in domains:
if domain.contains_offset(offset):
domain.deletions.append(offset)
[docs]
def add_insertion(self, helix: int, offset: int, length: int) -> None:
"""Adds an insertion with the given length to every :class:`scadnano.Strand`
at the given helix and base offset, with the given length."""
domains = self.domains_at(helix, offset)
if len(domains) == 0:
raise IllegalDesignError(f"no domains are at helix {helix} offset {offset}")
for domain in domains:
if domain.contains_offset(offset):
domain.insertions.append((offset, length))
[docs]
def set_start(self, domain: Domain, start: int) -> None:
"""Sets ``Domain.start`` to `start`."""
assert domain in (domain for strand in self.strands for domain in strand.domains)
domain.set_start(start)
self._check_strands_overlap_legally(domain)
[docs]
def set_end(self, domain: Domain, end: int) -> None:
"""Sets ``Domain.end`` to `end`."""
assert domain in (domain for strand in self.strands for domain in strand.domains)
domain.set_end(end)
self._check_strands_overlap_legally(domain)
[docs]
def move_strand_offsets(self, delta: int) -> None:
"""Moves all strands backward (if `delta` < 0) or forward (if `delta` > 0) by `delta`."""
for strand in self.strands:
for domain in strand.bound_domains():
domain.start += delta
domain.end += delta
self._check_strands_overlap_legally()
[docs]
def move_strands_on_helices(self, delta: int) -> None:
"""Moves all strands up (if `delta` < 0) or down (if `delta` > 0) by the number of helices given by
`delta`."""
for strand in self.strands:
for domain in strand.bound_domains():
domain.helix += delta
self._check_strands_reference_helices_legally()
[docs]
def assign_dna(
self,
strand: Strand,
sequence: str,
assign_complement: bool = True,
domain: Domain | Loopout | Extension | None = None,
check_length: bool = False,
) -> None:
"""
Assigns `sequence` as DNA sequence of `strand`.
If any :class:`scadnano.Strand` is bound to `strand`,
it is assigned the reverse Watson-Crick complement of the relevant portion,
and any remaining portions of the other strand that have not already been assigned a DNA sequence
are assigned to be the symbol :py:data:`DNA_base_wildcard`.
Before assigning, `sequence` is first forced to be the same length as `strand` as follows:
If `sequence` is longer, it is truncated.
If `sequence` is shorter, it is padded with :py:data:`DNA_base_wildcard`'s.
This can be disabled by setting `check_length` to True, in which case the method raises an
:any:`IllegalDesignError` if the lengths do not match.
All whitespace in `sequence` is removed, and lowercase bases
'a', 'c', 'g', 't' are converted to uppercase.
:param strand:
:any:`Strand` to assign DNA sequence to
:param sequence:
string of DNA bases to assign
:param assign_complement:
Whether to assign the complement DNA sequence to any :any:`Strand` that
is bound to this one (default True)
:param domain:
:any:`Domain` on `strand` to assign. If ``None``, then the whole :any:`Strand` is
given a DNA sequence. Otherwise, only `domain` is assigned, and the rest of the :any:`Domain`'s
on `strand` are left alone (either keeping their DNA sequence, or being assigned
:py:const:`DNA_base_wildcard` if no DNA sequence was previously assigned.)
If `domain` is specified, then ``len(sequence)`` must be least than or equal to the number
of bases on `domain`. (i.e., ``domain.dna_length()``)
:param check_length:
If True, raises :any:`IllegalDesignError` if length of :any:`Strand` or :any:`Domain` being
assigned to does not match the length of the DNA sequence.
:raises IllegalDesignError:
If `check_length` is True and the length of :any:`Strand` or :any:`Domain` being
assigned to does not match the length of the DNA sequence.
"""
start = 0
if domain is not None:
pos = strand.domains.index(domain)
start = sum(prev_dom.dna_length() for prev_dom in strand.domains[:pos])
if domain.dna_length() < len(sequence):
raise IllegalDesignError(
f"cannot assign sequence {sequence} to strand domain "
f"\n{domain}\n"
f"The number of bases on the domain is {domain.dna_length()} "
f"but the length of the sequence is {len(sequence)}. The length of "
f"the sequence must be at most the number of bases on the domain."
)
elif domain.dna_length() > len(sequence) and check_length:
raise IllegalDesignError(
f"cannot assign sequence {sequence} to strand domain "
f"\n{domain}\n"
f"The number of bases on the domain is {domain.dna_length()} "
f"but the length of the sequence is {len(sequence)}. Since the "
f"parameter `check_length` is set to True, these lengths must "
f"be exactly equal."
)
elif check_length and len(sequence) != strand.dna_length():
raise IllegalDesignError(
f"cannot assign sequence {sequence} to strand "
f"\n{strand}\n"
f"The number of bases on the strand is {strand.dna_length()} "
f"but the length of the sequence is {len(sequence)}. Since the "
f"parameter `check_length` is set to True, these lengths must "
f"be exactly equal."
)
padded_sequence = _pad_and_remove_whitespace_and_uppercase(sequence, strand, start)
if strand is None:
raise IllegalDesignError("strand cannot be None to assign DNA to it")
if strand not in self.strands:
raise StrandError(strand, "strand is not in the given Design")
if strand.dna_sequence is None:
merged_sequence = padded_sequence
else:
try:
merged_sequence = _string_merge_wildcard(strand.dna_sequence, padded_sequence, DNA_base_wildcard)
except ValueError:
first_domain = strand.first_domain()
msg = (
f"strand starting at helix {first_domain.helix}, offset {first_domain.offset_5p()} has "
f"length "
f"{strand.dna_length()} and already has a DNA sequence assignment of length "
f"{len(strand.dna_sequence)}, which is \n"
f"{strand.dna_sequence}, "
f"but you tried to assign a different sequence of length {len(padded_sequence)} to "
f"it, which is\n{padded_sequence}."
)
raise IllegalDesignError(msg)
strand.set_dna_sequence(merged_sequence)
if not assign_complement:
return
for other_strand in self.strands:
# note that possibly strand==other_strand; it might bind to itself at some point and we want to
# allow a partial assignment to one domain to automatically assign the complement to the
# bound domain.
# However, if there are no wildcards in the assigned sequence we can safely skip strand.
if (
strand == other_strand
and strand.dna_sequence is not None
and DNA_base_wildcard not in strand.dna_sequence
):
continue
if other_strand.overlaps(strand):
# we do this even if other_strand has a complete DNA sequence,
# because we get complementarity checks this way
other_strand.assign_dna_complement_from(strand)
def _idt_strands_to_export(
self,
*,
key: KeyFunction[Strand] | None = None, # for sorting strands
warn_duplicate_name: bool,
only_strands_with_vendor_fields: bool = False,
export_scaffold: bool = False,
export_non_modified_strand_version: bool = False,
) -> list[Strand]:
# gets list of strands to export for IDT export functions
added_strands: dict[str, Strand] = {} # dict: name -> strand
for strand in self.strands:
# skip scaffold unless requested to export
if strand.is_scaffold and not export_scaffold:
continue
# skip strands with no IDT field unless requested to export
if strand.vendor_fields is None and only_strands_with_vendor_fields:
continue
# figure out what name to export
name = strand.vendor_export_name()
if name in added_strands:
existing_strand = added_strands[name]
self._check_strands_with_same_name_agree_on_other_vendor_fields(
strand, existing_strand, name, warn_duplicate_name
)
added_strands[name] = strand
if export_non_modified_strand_version:
added_strands[name + "_nomods"] = strand.no_modifications_version()
strands = list(added_strands.values())
if key is not None:
strands.sort(key=key)
return strands
@staticmethod
def _check_strands_with_same_name_agree_on_other_vendor_fields(
strand: Strand,
existing_strand: Strand,
name: str,
warn_duplicate_name: bool,
) -> None:
# Handle the case that two strands being exported, strand and existing_strand
# (the latter was encountered first) have the same name
# This is allowed in case one wants to draw multiple copies of the same strand
# in scadnano without having to worry about setting their vendor fields differently.
# But then we need to check that they agree on everything being exported.
if existing_strand.name is not None:
assert existing_strand.name == name
domain = strand.first_domain()
existing_domain = existing_strand.first_domain()
if warn_duplicate_name:
print(
f"WARNING: two strands with same IDT name {name}:\n"
f" strand 1: helix {domain.helix}, 5' end at offset {domain.offset_5p()}\n"
f" strand 2: helix {existing_domain.helix}, 5' end at offset "
f"{existing_domain.offset_5p()}\n"
)
if strand.dna_sequence != existing_strand.dna_sequence:
raise IllegalDesignError(
f"two strands with same IDT name {name} but different sequences:\n"
f" strand 1: helix {domain.helix}, 5' end at offset {domain.offset_5p()}, "
f"sequence: {strand.dna_sequence}\n"
f" strand 2: helix {existing_domain.helix}, 5' end at offset "
f"{existing_domain.offset_5p()}, "
f"sequence: {existing_strand.dna_sequence}\n"
)
elif strand.vendor_fields is not None and existing_strand.vendor_fields is not None:
if strand.vendor_fields.scale != existing_strand.vendor_fields.scale:
raise IllegalDesignError(
f"two strands with same name {name} but different IDT scales:\n"
f" strand 1: helix {domain.helix}, 5' end at offset {domain.offset_5p()}, "
f"scale: {strand.vendor_fields.scale}\n"
f" strand 2: helix {existing_domain.helix}, 5' end at offset "
f"{existing_domain.offset_5p()}, "
f"scale: {existing_strand.vendor_fields.scale}\n"
)
elif strand.vendor_fields.purification != existing_strand.vendor_fields.purification:
raise IllegalDesignError(
f"two strands with same name {name} but different purifications:\n"
f" strand 1: helix {domain.helix}, 5' end at offset {domain.offset_5p()}, "
f"purification: {strand.vendor_fields.purification}\n"
f" strand 2: helix {existing_domain.helix}, 5' end at offset "
f"{existing_domain.offset_5p()}, "
f"purification: {existing_strand.vendor_fields.purification}\n"
)
[docs]
def write_idt_plate_excel_file(
self,
*,
directory: str = ".",
filename: str | None = None,
key: KeyFunction[Strand] | None = None,
warn_duplicate_name: bool = False,
only_strands_with_vendor_fields: bool = False,
export_scaffold: bool = False,
use_default_plates: bool = True,
warn_using_default_plates: bool = True,
plate_type: PlateType = PlateType.wells96,
export_non_modified_strand_version: bool = False,
) -> None:
"""
Write ``.xlsx`` (Microsoft Excel) file encoding the strands of this :any:`Design` with the field
:data:`Strand.vendor_fields`, suitable for uploading to IDT
(Integrated DNA Technologies, Coralville, IA, https://www.idtdna.com/)
to describe a 96-well or 384-well plate
(https://www.idtdna.com/site/order/plate/index/dna/),
with the output file having the same name as the running script but with ``.py`` changed to
``.xlsx``, unless `filename` is explicitly specified.
For instance, if the script is named ``my_origami.py``,
then the sequences will be written to ``my_origami.xlsx``.
If the last plate as fewer than 24 strands for a 96-well plate, or fewer than 96 strands for a
384-well plate, then the last two plates are rebalanced to ensure that each plate has at least
that number of strands, because IDT charges extra for a plate with too few strands:
https://www.idtdna.com/pages/products/custom-dna-rna/dna-oligos/custom-dna-oligos
:param directory:
specifies a directory in which to place the file, either absolute or relative to
the current working directory. Default is the current working directory.
:param filename:
custom filename if default (explained above) is not desired
:param key:
`key function <https://docs.python.org/3/howto/sorting.html#key-functions>`_ used to determine
order in which to output strand sequences. Some useful defaults are provided by
:py:meth:`strand_order_key_function`
:param warn_duplicate_name:
if ``True`` prints a warning when two different :any:`Strand`'s have the same
:data:`Strand.name` and the same :any:`Strand.dna_sequence`. An :any:`IllegalDesignError` is
raised (regardless of the value of this parameter)
if two different :any:`Strand`'s have the same name but different sequences, IDT scales, or IDT
purifications.
:param only_strands_with_vendor_fields:
If False (the default), all non-scaffold sequences are output, with reasonable default values
chosen if the field :data:`Strand.vendor_fields` is missing.
(though scaffold is included if `export_scaffold` is True).
If True, then strands lacking the field :data:`Strand.vendor_fields` will not be exported.
If False, then `use_default_plates` must be True.
:param export_scaffold:
If False (the default), scaffold sequences are not exported.
If True, scaffold sequences on strands output according to `only_strands_with_vendor_fields`
(i.e., scaffolds will be exported, unless they lack the field :any:`Strand.vendor_fields` and
`only_strands_with_vendor_fields` is True).
:param use_default_plates:
Use default values for plate and well (ignoring those in idt fields, which may be None).
If False, each Strand to export must have the field :data:`Strand.vendor_fields`, so in particular
the parameter `only_strands_with_vendor_fields` must be True.
:param warn_using_default_plates:
specifies whether, if `use_default_plates` is True, to print a warning for strands whose
:data:`Strand.vendor_fields` has the fields :data:`VendorFields.plate` and :data:`VendorFields.well`,
since `use_default_plates` directs these fields to be ignored.
:param plate_type:
a :any:`PlateType` specifying whether to use a 96-well plate or a 384-well plate
if the `use_default_plates` parameter is ``True``.
Ignored if `use_default_plates` is ``False``, because in that case the wells are explicitly set
by the user, who is free to use coordinates for either plate type.
:param export_non_modified_strand_version:
For any :any:`Strand` with a :any:`Modification`, also export a version of the :any:`Strand`
without any modifications. The name for this :any:`Strand` is the original name with
'_nomods' appended to it.
"""
strands_to_export = self._idt_strands_to_export(
key=key,
warn_duplicate_name=warn_duplicate_name,
only_strands_with_vendor_fields=only_strands_with_vendor_fields,
export_scaffold=export_scaffold,
export_non_modified_strand_version=export_non_modified_strand_version,
)
if not use_default_plates:
if not only_strands_with_vendor_fields:
raise ValueError(
"parameters use_default_plates and only_strands_with_vendor_fields cannot both be False"
)
self._write_plates_assuming_explicit_plates_in_each_strand(directory, filename, strands_to_export)
else:
self._write_plates_default(
directory=directory,
filename=filename,
strands=strands_to_export,
plate_type=plate_type,
warn_using_default_plates=warn_using_default_plates,
)
def _write_plates_assuming_explicit_plates_in_each_strand(
self, directory: str, filename: str | None, strands_to_export: list[Strand]
) -> None:
plates = list(
{
strand.vendor_fields.plate
for strand in strands_to_export
if strand.vendor_fields is not None
if strand.vendor_fields.plate is not None
}
)
if len(plates) == 0:
raise ValueError(
"Cannot write a a plate file since no plate data exists in any Strands "
"in the design.\n"
"Set the option use_default_plates=True in "
"Design.write_idt_plate_excel_file\nif you don't want to enter plate "
"and well positions for each Strand you wish to write to the Excel file."
)
plates.sort()
filename_plate, workbook = self._setup_excel_file(directory, filename)
for plate in plates:
worksheet = self._add_new_excel_plate_sheet(plate, workbook)
strands_in_plate = [
strand
for strand in strands_to_export
if strand.vendor_fields is not None and strand.vendor_fields.plate == plate
]
strands_in_plate.sort(key=lambda s: (int(s.vendor_fields.well[1:]), s.vendor_fields.well[0])) # type: ignore
for row, strand in enumerate(strands_in_plate):
if strand.vendor_fields is None:
raise ValueError(f"cannot export strand {strand} to IDT because it has no idt field")
worksheet.cell(row + 2, 1).value = strand.vendor_fields.well
worksheet.cell(row + 2, 2).value = strand.vendor_export_name()
worksheet.cell(row + 2, 3).value = strand.vendor_dna_sequence()
workbook.save(filename_plate)
# TODO: fix types when openpyxl supports type hints
@staticmethod
def _add_new_excel_plate_sheet(plate_name: str, workbook: "openpyxl.Workbook") -> Any:
worksheet = workbook.create_sheet(title=plate_name)
worksheet.cell(1, 1).value = "Well Position"
worksheet.cell(1, 2).value = "Name"
worksheet.cell(1, 3).value = "Sequence"
return worksheet
@staticmethod
def _setup_excel_file(directory: str, filename: str | None) -> tuple[str, "openpyxl.Workbook"]:
import openpyxl # type: ignore
plate_extension = "xlsx"
if filename is None:
filename_plate = _get_filename_same_name_as_running_python_script(directory, plate_extension, filename)
else:
filename_plate = _create_directory_and_set_filename(directory, filename)
workbook = openpyxl.Workbook()
workbook.remove(workbook.active) # removed automatically created default sheet
return filename_plate, workbook
def _write_plates_default(
self,
directory: str,
filename: str | None,
strands: list[Strand],
plate_type: PlateType = PlateType.wells96,
warn_using_default_plates: bool = True,
) -> None:
plate_coord = PlateCoordinate(plate_type=plate_type)
plate = 1
excel_row = 1
filename_plate, workbook = self._setup_excel_file(directory, filename)
worksheet = self._add_new_excel_plate_sheet(f"plate{plate}", workbook)
num_strands_per_plate = plate_type.num_wells_per_plate()
num_plates_needed = len(strands) // num_strands_per_plate
if len(strands) % num_strands_per_plate != 0:
num_plates_needed += 1
min_strands_per_plate = plate_type.min_wells_per_plate()
num_strands_plates_except_final = max(0, (num_plates_needed - 1) * num_strands_per_plate)
num_strands_final_plate = len(strands) - num_strands_plates_except_final
final_plate_less_than_min_required = num_strands_final_plate < min_strands_per_plate
num_strands_remaining = len(strands)
on_final_plate = num_plates_needed == 1
for strand in strands:
if strand.vendor_fields is not None:
if warn_using_default_plates and strand.vendor_fields.plate is not None:
print(
f"WARNING: strand {strand} has plate entry {strand.vendor_fields.plate}, "
f"which is being ignored since we are using default plate/well addressing"
)
if warn_using_default_plates and strand.vendor_fields.well is not None:
print(
f"WARNING: strand {strand} has well entry {strand.vendor_fields.well}, "
f"which is being ignored since we are using default plate/well addressing"
)
well = plate_coord.well()
worksheet.cell(excel_row + 1, 1).value = well
worksheet.cell(excel_row + 1, 2).value = strand.vendor_export_name()
worksheet.cell(excel_row + 1, 3).value = strand.vendor_dna_sequence()
num_strands_remaining -= 1
# IDT charges extra for a plate with < 24 strands for 96-well plate
# or < 96 strands for 384-well plate.
# So if we would have fewer than that many on the last plate,
# shift some from the penultimate plate.
if (
not on_final_plate
and final_plate_less_than_min_required
and num_strands_remaining == min_strands_per_plate
):
plate_coord.advance_to_next_plate()
else:
plate_coord.advance()
if plate != plate_coord.plate():
workbook.save(filename_plate)
plate = plate_coord.plate()
worksheet = self._add_new_excel_plate_sheet(f"plate{plate}", workbook)
excel_row = 1
else:
excel_row += 1
workbook.save(filename_plate)
[docs]
def write_oxview_file(
self,
directory: str = ".",
filename: str | None = None,
warn_duplicate_strand_names: bool = True,
use_strand_colors: bool = True,
) -> None:
"""Writes an oxView file rerpesenting this design.
:param directory:
directy in which to write the file (default: current working directory)
:param filename:
name of the file to write (default: name of the running script with .oxview extension)
:param warn_duplicate_strand_names:
if True, prints a warning to the screen indicating when strands are found to
have duplicate names. (default: True)
:param use_strand_colors:
if True (default), sets the color of each nucleotide in a strand in oxView to the color
of the strand.
"""
text = self.to_oxview_format(
warn_duplicate_strand_names=warn_duplicate_strand_names, use_strand_colors=use_strand_colors
)
write_file_same_name_as_running_python_script(text, "oxview", directory, filename)
[docs]
def to_oxview_json(self, warn_duplicate_strand_names: bool = True, use_strand_colors: bool = True) -> dict:
"""
Exports to oxView format: https://github.com/sulcgroup/oxdna-viewer/blob/master/file-format.md
:param warn_duplicate_strand_names:
if True, prints a warning to the screen indicating when strands are found to
have duplicate names. (default: True)
:param use_strand_colors:
if True (default), sets the color of each nucleotide in a strand in oxView to the color
of the strand.
:return:
Python dict
"""
import datetime
self._check_legal_design(warn_duplicate_strand_names)
system = _convert_design_to_oxdna_system(self)
oxview_strands: list[dict[str, Any]] = []
nuc_count = 0
strand_count = 0
strand_nuc_start = [-1]
for sc_strand, oxdna_strand in zip(self.strands, system.strands):
strand_count += 1
oxvnucs: list[dict[str, Any]] = []
strand_nuc_start.append(nuc_count)
oxvstrand = {
"id": strand_count,
"class": "NucleicAcidStrand",
"end5": nuc_count,
"end3": nuc_count + len(oxdna_strand.nucleotides),
"monomers": oxvnucs,
}
if use_strand_colors and (sc_strand.color is not None):
scolor = sc_strand.color.to_cadnano_v2_int_hex()
else:
scolor = None
for index_in_strand, nuc in enumerate(oxdna_strand.nucleotides):
oxvnuc = {
"id": nuc_count,
"p": [nuc.r.x, nuc.r.y, nuc.r.z],
"a1": [nuc.b.x, nuc.b.y, nuc.b.z],
"a3": [nuc.n.x, nuc.n.y, nuc.n.z],
"class": "DNA",
"type": nuc.base,
"cluster": 1,
}
if index_in_strand != 0:
oxvnuc["n5"] = nuc_count - 1
if index_in_strand != len(oxdna_strand.nucleotides) - 1:
oxvnuc["n3"] = nuc_count + 1
if use_strand_colors and (scolor is not None):
oxvnuc["color"] = scolor
nuc_count += 1
oxvnucs.append(oxvnuc)
oxview_strands.append(oxvstrand)
for si1, (sc_strand1, oxv_strand1) in enumerate(zip(self.strands, oxview_strands)):
for si2, sc_strand2 in enumerate(self.strands):
if not sc_strand1.overlaps(sc_strand2):
continue
s1_nuc_idx = strand_nuc_start[si1 + 1]
for domain1 in sc_strand1.domains:
if isinstance(domain1, (Loopout, Extension)):
continue
s2_nuc_idx = strand_nuc_start[si2 + 1]
for domain2 in sc_strand2.domains:
if isinstance(domain2, (Loopout, Extension)):
continue
if not domain1.overlaps(domain2):
continue
overlap_left, overlap_right = domain1.compute_overlap(domain2)
s1_left = domain1.domain_offset_to_strand_dna_idx(overlap_left, False)
s1_right = domain1.domain_offset_to_strand_dna_idx(overlap_right, False)
s2_left = domain2.domain_offset_to_strand_dna_idx(overlap_left, False)
s2_right = domain2.domain_offset_to_strand_dna_idx(overlap_right, False)
if domain1.forward:
d1range = range(s1_left, s1_right)
d2range = range(s2_left, s2_right, -1)
else:
d1range = range(s1_right + 1, s1_left + 1)
d2range = range(s2_right - 1, s2_left - 1, -1)
assert len(d1range) == len(d2range)
# Check for mismatches, and do not add a pair if the bases are *known*
# to mismatch. (FIXME: this must be changed if scadnano later supports
# degenerate base codes.)
for d1, d2 in zip(d1range, d2range):
if (
(sc_strand1.dna_sequence is not None)
and (sc_strand2.dna_sequence is not None)
and (sc_strand1.dna_sequence[d1] != DNA_base_wildcard)
and (sc_strand2.dna_sequence[d2] != DNA_base_wildcard)
and (rc(sc_strand1.dna_sequence[d1]) != sc_strand2.dna_sequence[d2])
):
continue
oxv_strand1["monomers"][d1]["bp"] = s2_nuc_idx + d2
if "bp" in oxview_strands[si2]["monomers"][d2]:
if oxview_strands[si2]["monomers"][d2]["bp"] != s1_nuc_idx + d1:
print(
s2_nuc_idx + d2,
s1_nuc_idx + d1,
oxview_strands[si2]["monomers"][d2]["bp"],
domain1,
domain2,
)
b = system.compute_bounding_box()
oxvsystem = {
"box": [b.x, b.y, b.z],
"date": datetime.datetime.now().isoformat(),
"systems": [{"id": 0, "strands": oxview_strands}],
"forces": [],
"selections": [],
}
return oxvsystem
[docs]
def write_oxdna_files(
self,
directory: str = ".",
filename_no_extension: str | None = None,
warn_duplicate_strand_names: bool = True,
) -> None:
"""Write text file representing this :any:`Design`,
suitable for reading by oxdna (https://sulcgroup.github.io/oxdna-viewer/),
with the output files having the same name as the running script but with ``.py`` changed to
``.dat`` and ``.top``,
unless `filename_no_extension` is explicitly specified.
For instance, if the script is named ``my_origami.py``,
then the design will be written to ``my_origami.dat`` and ``my_origami.top``.
The strings written are those returned by :meth:`Design.to_oxdna_format`.
The three angles of each :any:`HelixGroup` are interpreted to be applied in the following order:
first :data:`HelixGroup.yaw`, then :data:`HelixGroup.pitch`, then :data:`HelixGroup.roll`,
using the "intrinsic rotation" convention
(see https://en.wikipedia.org/wiki/Euler_angles#Conventions_by_intrinsic_rotations).
The value :data:`Helix.roll` is added to the value :data:`HelixGroup.roll`.
:param directory:
directory in which to put file (default: current working directory)
:param filename_no_extension:
filename without extension (default: name of running script without ``.py``).
:param warn_duplicate_strand_names:
If True, prints a warning to the screen indicating when
strands are found to have duplicate names.
"""
dat, top = self.to_oxdna_format(warn_duplicate_strand_names)
write_file_same_name_as_running_python_script(dat, "dat", directory, filename_no_extension, add_extension=True)
write_file_same_name_as_running_python_script(top, "top", directory, filename_no_extension, add_extension=True)
# @_docstring_parameter was used to substitute sc in for the filename extension, but it is
# incompatible with .. code-block:: and caused a very strange and hard-to-determine error,
# so I removed it.
# @_docstring_parameter(default_extension=default_scadnano_file_extension)
[docs]
def write_scadnano_file(
self,
filename: str | None = None,
directory: str = ".",
extension: str | None = None,
suppress_indent: bool = True,
warn_duplicate_strand_names: bool = True,
) -> None:
"""Write text file representing this :any:`Design`,
suitable for reading by the scadnano web interface,
with the output file having the same name as the running script but with ``.py`` changed to
:attr:`default_scadnano_file_extension`,
unless `filename` is explicitly specified.
For instance, if the script is named ``my_origami.py``,
then the design will be written to ``my_origami.sc``.
If `extension` is specified (but `filename` is not), then the design will be written to
``my_origami.<extension>``
The string written is that returned by :meth:`Design.to_json`.
:param filename:
filename (default: name of script with ``.py`` replaced by
``.sc``).
Mutually exclusive with `extension`
:param directory:
directory in which to put file (default: current working directory)
:param extension:
extension for filename (default: ``.sc``)
Mutually exclusive with `filename`
:param warn_duplicate_strand_names:
If True, prints a warning to the screen indicating when
strands are found to have duplicate names.
:param suppress_indent: whether to suppress indenting JSON for "small" objects such as short lists,
e.g., grid coordinates. If True, something like this will be written:
.. code-block:: JSON
{
"grid_position": [1, 2]
}
instead of this:
.. code-block:: JSON
{
"grid_position": [
1,
2
]
}
"""
self._check_legal_design(warn_duplicate_strand_names)
contents = self.to_json(suppress_indent)
if filename is not None and extension is not None:
raise ValueError("at least one of filename or extension must be None")
if extension is None:
extension = default_scadnano_file_extension
write_file_same_name_as_running_python_script(contents, extension, directory, filename)
[docs]
def write_cadnano_v2_file(self, directory: str = ".", filename: str | None = None, whitespace: bool = True) -> None:
"""Write ``.json`` file representing this :any:`Design`, suitable for reading by cadnano v2.
The string written is that returned by :meth:`Design.to_cadnano_v2`.
If the cadnano file is intended to be used with CanDo (https://cando-dna-origami.org/),
the optional parameter `whitespace` must be set to False.
:param directory:
directory in which to place the file, either absolute or relative to
the current working directory. Default is the current working directory.
:param whitespace:
Whether to include whitespace in the exported file. Set to False to use this with CanDo
(https://cando-dna-origami.org/), since that tool generates an error if the cadnano file
contains whitespace.
:param filename:
The output file has the same name as the running script but with ``.py`` changed to ``.json``,
unless `filename` is explicitly specified.
For instance, if the script is named ``my_origami.py``,
then if filename is not specified, the design will be written to ``my_origami.json``.
"""
name = _get_filename_same_name_as_running_python_script(directory, "json", filename)
content = self.to_cadnano_v2_json(name=name, whitespace=whitespace)
write_file_same_name_as_running_python_script(content, "json", directory, filename)
[docs]
def add_nick(self, helix: int, offset: int, forward: bool, new_color: bool = True) -> None:
"""Add nick to :any:`Domain` on :any:`Helix` with index `helix`,
in direction given by `forward`, at offset `offset`. The two :any:`Domain`'s created by this nick
will have 5'/3' ends at offsets `offset` and `offset-1`.
For example, if there is a :any:`Domain` with
:py:data:`Domain.helix` = ``0``,
:py:data:`Domain.forward` = ``True``,
:py:data:`Domain.start` = ``0``,
:py:data:`Domain.end` = ``10``,
then calling ``add_nick(helix=0, offset=5, forward=True)`` will split it into two :any:`Domain`'s,
with one domains having the fields
:py:data:`Domain.helix` = ``0``,
:py:data:`Domain.forward` = ``True``,
:py:data:`Domain.start` = ``0``,
:py:data:`Domain.end` = ``5``,
(recall that :py:data:`Domain.end` is exclusive, meaning that the largest offset on this
:any:`Domain` is 4 = ``offset-1``)
and the other domain having the fields
:py:data:`Domain.helix` = ``0``,
:py:data:`Domain.forward` = ``True``,
:py:data:`Domain.start` = ``5``,
:py:data:`Domain.end` = ``10``.
If the :any:`Strand` is circular, then it will be made linear with the 5' and 3' ends at the
nick position, modified in place. Otherwise, this :any:`Strand` will be deleted from the design,
and two new :any:`Strand`'s will be added.
:param helix:
index of helix where nick will occur
:param offset:
offset to nick (nick will be between offset and offset-1)
:param forward:
forward or reverse :any:`Domain` on `helix` at `offset`?
:param new_color:
whether to assign a new color to one of the :any:`Strand`'s resulting from the nick.
If False, both :any:`Strand`'s created have the same color as the original.
If True, one :any:`Strand` keeps the same color as the original and the other
is assigned a new color.
"""
# check that a domain exists at the proper address
for domain_to_remove in self.domains_at(helix, offset):
if domain_to_remove.forward == forward:
break
else:
raise IllegalDesignError(
f"no domain at helix {helix} in direction {'forward' if forward else 'reverse'} at offset {offset}"
)
strand = domain_to_remove.strand()
domains = strand.domains
order = domains.index(domain_to_remove)
# TODO: what if these are extensions or loopouts?
domains_before = domains[:order]
domains_after = domains[order + 1 :]
domain_left: Domain = Domain(helix, forward, domain_to_remove.start, offset)
domain_right: Domain = Domain(helix, forward, offset, domain_to_remove.end)
# "before" and "after" mean in the 5' --> 3' direction, i.e., if a reverse domain:
# <--------]
# nicked like this:
# <---]<---]
# The before domain is on the right and the after domain is on the left.
#
# If nicking a forward domain:
# [-------->
# nicked like this:
# [--->[--->
# The before domain is on the left and the after domain is on the right.
if domain_to_remove.forward:
domain_to_add_before = domain_left
domain_to_add_after = domain_right
else:
domain_to_add_before = domain_right
domain_to_add_after = domain_left
seq_before_whole: str | None
seq_after_whole: str | None
if strand.dna_sequence is not None:
seq_before: str = "".join(domain.dna_sequence for domain in domains_before) # type: ignore
seq_after: str = "".join(domain.dna_sequence for domain in domains_after) # type: ignore
seq_on_domain_left: str = domain_to_remove.dna_sequence_in( # type: ignore
domain_to_remove.start, offset - 1
)
seq_on_domain_right: str = domain_to_remove.dna_sequence_in(
offset, # type: ignore
domain_to_remove.end - 1,
)
if domain_to_remove.forward:
seq_on_domain_before = seq_on_domain_left
seq_on_domain_after = seq_on_domain_right
else:
seq_on_domain_before = seq_on_domain_right
seq_on_domain_after = seq_on_domain_left
seq_before_whole = seq_before + seq_on_domain_before
seq_after_whole = seq_on_domain_after + seq_after
else:
seq_before_whole = None
seq_after_whole = None
domains_before = domains_before + cast(list[Domain | Loopout | Extension], [domain_to_add_before]) # noqa
domains_after = cast(list[Domain | Loopout | Extension], [domain_to_add_after]) + domains_after # noqa
if strand.circular:
# if strand is circular, we modify its domains in place
domains = domains_after + domains_before
strand.set_domains(domains)
# DNA sequence was rotated, so re-assign it
if seq_before_whole is not None and seq_after_whole is not None:
seq = seq_before_whole + seq_after_whole
strand.set_dna_sequence(seq)
strand.set_linear()
else:
# if strand is not circular, we delete it and create two new strands
self.strands.remove(strand)
strand_before: Strand = Strand(
domains=domains_before,
dna_sequence=seq_before_whole,
color=strand.color,
vendor_fields=strand.vendor_fields,
)
color_after = next(self.color_cycler) if new_color else strand.color
strand_after: Strand = Strand(
domains=domains_after,
dna_sequence=seq_after_whole,
color=color_after,
)
# TODO: put in same position as original strand
self.strands.extend([strand_before, strand_after])
# update helix field that maintains list of all domains on it
helix_domains = self.helices[helix].domains
idx_domain_to_remove = helix_domains.index(domain_to_remove)
helix_domains[idx_domain_to_remove] = domain_left
helix_domains.insert(idx_domain_to_remove + 1, domain_right)
[docs]
def ligate(self, helix: int, offset: int, forward: bool) -> None:
"""
Reverse operation of :py:meth:`Design.add_nick`.
"Ligates" a nick between two adjacent :any:`Domain`'s in the same direction on a :any:`Helix`
with index `helix`,
in direction given by `forward`, at offset `offset`.
For example, if there are a :any:`Domain`'s with
:py:data:`Domain.helix` = ``0``,
:py:data:`Domain.forward` = ``True``,
:py:data:`Domain.start` = ``0``,
:py:data:`Domain.end` = ``5``,
(recall that :py:data:`Domain.end` is exclusive, meaning that the largest offset on this
:any:`Domain` is 4 = ``offset-1``)
and the other domain having the fields
:py:data:`Domain.helix` = ``0``,
:py:data:`Domain.forward` = ``True``,
:py:data:`Domain.start` = ``5``,
:py:data:`Domain.end` = ``10``.
then calling ``ligate(helix=0, offset=5, forward=True)`` will combine them into one :any:`Domain`,
having the fields
:py:data:`Domain.helix` = ``0``,
:py:data:`Domain.forward` = ``True``,
:py:data:`Domain.start` = ``0``,
:py:data:`Domain.end` = ``10``.
If the :any:`Domain`'s are on the same :any:`Strand` (i.e., they are the 5' and 3' ends of that
:any:`Strand`, which is necessarily linear), then the :any:`Strand` is made is circular in place,
Otherwise, the two :any:`Strand`'s of each :any:`Domain` will be joined into one,
replacing the previous strand on the 5'-most side of the nick (i.e., the one whose 3' end
terminated at the nick), and deleting the other strand.
:param helix:
index of helix where nick will be ligated
:param offset:
offset to ligate (nick to ligate must be between offset and offset-1)
:param forward:
forward or reverse :any:`Domain` on `helix` at `offset`?
"""
for dom_right in self.domains_at(helix, offset):
if dom_right.forward == forward:
break
else:
raise IllegalDesignError(
f"no domain at helix {helix} in direction {'forward' if forward else 'reverse'} at offset {offset}"
)
for dom_left in self.domains_at(helix, offset - 1):
if dom_left.forward == forward:
break
else:
raise IllegalDesignError(
f"no domain at helix {helix} in direction {'forward' if forward else 'reverse'} at offset {offset}"
)
if dom_right.start != offset:
raise IllegalDesignError(
f"to ligate at offset {offset}, it must be the start offset of a domain,"
f"but there is no domain at helix {helix} in direction "
f"{'forward' if forward else 'reverse'} with start offset = {offset}"
)
if dom_left.end != offset:
raise IllegalDesignError(
f"to ligate at offset {offset}, it must be the end offset of a domain,"
f"but there is no domain at helix {helix} in direction "
f"{'forward' if forward else 'reverse'} with end offset = {offset}"
)
strand_left = dom_left.strand()
strand_right = dom_right.strand()
dom_new: Domain = Domain(
helix=helix,
forward=forward,
start=dom_left.start,
end=dom_right.end,
deletions=dom_left.deletions + dom_right.deletions,
insertions=dom_left.insertions + dom_right.insertions,
name=dom_left.name,
label=dom_left.label,
)
# normalize 5'/3' distinction; below refers to which Strand has the 5'/3' end that will be ligated
# So strand_5p is the one whose 3' end will be the 3' end of the whole new Strand
# strand_5p and dom_5p are the ones on the 5' side of the nick,
# CAUTION: they are on the 3' side of the nick,
# i.e., the 3' end of strand_5p will be the 3' end of the new strand
# e.g.,
#
# strand_3p strand_5p
# [--------->[--------->
# dom_3p dom_5p
#
# or
#
# strand_5p strand_3p
# <---------]<---------]
# dom_5p dom_3p
if not forward:
dom_5p = dom_left
dom_3p = dom_right
strand_5p = strand_left
strand_3p = strand_right
else:
dom_5p = dom_right
dom_3p = dom_left
strand_5p = strand_right
strand_3p = strand_left
if strand_5p.domains[0] != dom_5p:
raise IllegalDesignError(
f'Domain to be ligated "{dom_5p.name}"does not reside on the 5\' end of the strand.'
)
if strand_3p.domains[-1] != dom_3p:
raise IllegalDesignError(f'Domain to be ligated "{dom_3p.name}"does not reside on the 3\' of the strand.')
if strand_left is strand_right:
# join domains and make strand circular
strand = strand_left
assert strand.first_bound_domain() is dom_5p
assert strand.last_bound_domain() is dom_3p
strand.domains[0] = dom_new # set first domain equal to new joined domain
strand.domains.pop() # remove last domain
strand.set_circular()
for domain in strand.domains:
domain._parent_strand = strand
else:
# join strands
old_strand_3p_dna_sequence = strand_3p.dna_sequence
old_strand_5p_dna_sequence = strand_5p.dna_sequence
strand_3p.domains.pop()
strand_3p.domains.append(dom_new)
strand_3p.domains.extend(strand_5p.domains[1:])
strand_3p.is_scaffold = strand_left.is_scaffold or strand_right.is_scaffold
if strand_5p.modification_3p is not None:
strand_3p.set_modification_3p(strand_5p.modification_3p)
for idx, mod in strand_5p.modifications_int.items():
new_idx = idx + strand_3p.dna_length()
strand_3p.set_modification_internal(new_idx, mod)
if old_strand_3p_dna_sequence is not None and old_strand_5p_dna_sequence is not None:
strand_3p.set_dna_sequence(old_strand_3p_dna_sequence + old_strand_5p_dna_sequence)
if strand_5p.is_scaffold and not strand_3p.is_scaffold and strand_5p.color is not None:
strand_3p.set_color(strand_5p.color)
self.strands.remove(strand_5p)
for domain in strand_3p.domains:
domain._parent_strand = strand_3p
helix_domains = self.helices[helix].domains
idx_domain_to_remove_left = helix_domains.index(dom_left)
helix_domains[idx_domain_to_remove_left] = dom_new
helix_domains.remove(dom_right)
[docs]
def add_half_crossover(
self,
helix: int,
helix2: int,
offset: int,
forward: bool,
offset2: int | None = None,
forward2: bool | None = None,
) -> None:
"""
Add a half crossover from helix `helix` at offset `offset` to `helix2`, on the strand
with :py:data:`Strand.forward` = `forward`.
Unlike :py:meth:`Design.add_full_crossover`, which automatically adds a nick between the two
half-crossovers, to call this method, there must *already* be nicks adjacent to the given
offsets on the given helices. (either on the left or right side)
If the crossover is within a :any:`Strand`, i.e., between its 5' and ' ends, the :any:`Strand`
will simply be made circular, modifying it in place. Otherwise, the old two :any:`Strand`'s will be
deleted, and a new :any:`Strand` added.
:param helix:
index of one helix of half crossover
:param helix2:
index of other helix of half crossover
:param offset:
offset on `helix` at which to add half crossover
:param forward:
direction of :any:`Strand` on `helix` to which to add half crossover
:param offset2:
offset on `helix2` at which to add half crossover.
If not specified, defaults to `offset`
:param forward2: direction of :any:`Strand` on `helix2` to which to add half crossover.
If not specified, defaults to the negation of `forward`
"""
if offset2 is None:
offset2 = offset
if forward2 is None:
forward2 = not forward
domain1 = self.domain_at(helix, offset, forward)
domain2 = self.domain_at(helix2, offset2, forward2)
if domain1 is None:
raise IllegalDesignError(
f"Cannot add half crossover at (helix={helix}, offset={offset}). There is no Domain there."
)
if domain2 is None:
raise IllegalDesignError(
f"Cannot add half crossover at (helix={helix2}, offset={offset2}). There is no Domain there."
)
strand1 = domain1.strand()
strand2 = domain2.strand()
if strand1 == strand2:
strand1.set_circular()
return
# raise IllegalDesignError(f"Cannot add crossover from "
# f"(helix={helix}, offset={offset}) to "
# f"(helix={helix2}, offset={offset2}) "
# f"because that would join two Domains "
# f"already on the same Strand! "
# f"Currently circular Strands are not supported. "
# f"Instead, try adding nicks first, or rearrange the order of "
# f"crossover addition, to ensure that all strands are "
# f"non-circular, even in intermediate stages.")
if domain1.offset_3p() == offset and domain2.offset_5p() == offset2:
strand_first = strand1
strand_last = strand2
domain_first = domain1
domain_last = domain2
elif domain1.offset_5p() == offset and domain2.offset_3p() == offset2:
strand_first = strand2
strand_last = strand1
domain_first = domain2
domain_last = domain1
else:
raise IllegalDesignError(
"Cannot add half crossover. Must have one domain have its "
"5' end at the given offset and the other with its 3' end at the "
"given offset, but this is not the case."
)
if strand_first.domains[-1] is not domain_first:
raise IllegalDesignError(
f"Domain to add crossover to: {domain_first} is expected to be on the 3' "
f"end of the strand, but this is not the case."
)
if strand_last.domains[0] is not domain_last:
raise IllegalDesignError(
f"Domain to add crossover to: {domain_last} is expected to be on the 5' "
f"end of the strand, but this is not the case."
)
new_domains = strand_first.domains + strand_last.domains
if strand_first.dna_sequence is None and strand_last.dna_sequence is None:
new_dna = None
elif strand_first.dna_sequence is not None and strand_last.dna_sequence is not None:
new_dna = strand_first.dna_sequence + strand_last.dna_sequence
else:
raise IllegalDesignError(
"cannot add crossover between two strands if one has a DNA sequence and the other does not"
)
new_strand: Strand = Strand(
domains=new_domains,
color=strand_first.color,
dna_sequence=new_dna,
vendor_fields=strand_first.vendor_fields,
is_scaffold=strand1.is_scaffold or strand2.is_scaffold,
)
# put new strand in place where strand_first was
strand_first_idx = self.strands.index(strand_first)
self.strands[strand_first_idx] = new_strand
self.strands.remove(strand_last)
[docs]
def add_full_crossover(
self,
helix: int,
helix2: int,
offset: int,
forward: bool,
offset2: int | None = None,
forward2: bool | None = None,
) -> None:
"""
Adds two half-crossovers, one at `offset` and another at `offset`-1.
Other arguments have the same meaning as in :py:meth:`Design.add_half_crossover`.
A nick is automatically added on helix `helix` between
`offset` and `offset`-1 if one is not already present,
and similarly for `offset2` on helix `helix2`.
:param helix:
index of one helix of half crossover
:param helix2:
index of other helix of half crossover
:param offset:
offset on `helix` at which to add half crossover
:param forward:
direction of :any:`Strand` on `helix` to which to add half crossover
:param offset2:
offset on `helix2` at which to add half crossover.
If not specified, defaults to `offset`
:param forward2: direction of :any:`Strand` on `helix2` to which to add half crossover.
If not specified, defaults to the negation of `forward`
"""
if offset2 is None:
offset2 = offset
if forward2 is None:
forward2 = not forward
for helix_, forward_, offset_ in [(helix, forward, offset), (helix2, forward2, offset2)]:
self._prepare_nicks_for_full_crossover(helix_, forward_, offset_)
self.add_half_crossover(
helix=helix, helix2=helix2, offset=offset - 1, offset2=offset2 - 1, forward=forward, forward2=forward2
)
self.add_half_crossover(
helix=helix, helix2=helix2, offset=offset, offset2=offset2, forward=forward, forward2=forward2
)
def _prepare_nicks_for_full_crossover(self, helix: int, forward: bool, offset: int) -> None:
domain_right = self.domain_at(helix, offset, forward)
if domain_right is None:
raise IllegalDesignError(
f"You tried to create a full crossover at "
f"(helix={helix}, offset={offset}) "
f"but there is no Strand there."
)
domain_left = self.domain_at(helix, offset - 1, forward)
if domain_left is None:
raise IllegalDesignError(
f"You tried to create a full crossover at "
f"(helix={helix}, offset={offset}) "
f"but there is no Strand at offset {offset - 1}."
)
if domain_left == domain_right:
self.add_nick(helix, offset, forward)
else:
# there's already a nick here (unless either has a crossover; see error check below)
assert domain_left.end == domain_right.start
# disallowed situations:
# -->---+^+--->-- not domain_left.is_5p_domain() or not domain_right.is_3p_domain()
# --<---+^+---<-- not domain_left.is_3p_domain() or not domain_right.is_3p_domain()
if (
not domain_left.is_5p_domain()
or not domain_right.is_3p_domain()
or not domain_left.is_3p_domain()
or not domain_right.is_5p_domain()
):
raise IllegalDesignError(
"cannot add crossover at address "
f"(helix={helix}, offset={offset}, forward={forward}) "
"because there is already a crossover there"
)
[docs]
def inline_deletions_insertions(self) -> None:
"""
Converts deletions and insertions by "inlining" them. Insertions and deletions are removed,
and their domains have their lengths altered. Also, major tick marks on the helices will be
shifted to preserve their adjacency to bases already present. For example, if there are major
tick marks at 0, 8, 18, 24, and a deletion between 0 and 8:
.. code-block:: none
0 8 18 24 30
|--X---|---------|-----|------
then the domain is shortened by 1,
the tick marks become 0, 7, 15, 23,
and the helix's maximum offset is shrunk by 1:
.. code-block:: none
0 7 17 23 29
|-----|---------|-----|------
Similarly, if there are insertions (in the example below, the "2" represents an insertion of length 2,
which represents 3 total bases), they are expanded
.. code-block:: none
0 8 18 24 30
|--2---|---------|-----|------
then the domain is lengthened by 3:
.. code-block:: none
0 10 20 26 32
|--------|---------|-----|------
And it works if there are both insertions and deletions:
.. code-block:: none
0 8 18 24 30
|--2---|---------|--X--|------
then the domain is lengthened by 3:
.. code-block:: none
0 10 20 25 31
|--------|---------|----|------
We assume that a major tick mark appears just to the LEFT of the offset it encodes,
so the minimum and maximum offsets for tick marks are respectively the helix's minimum offset
and 1 plus its maximum offset, the latter being just to the right of the last offset on the helix.
"""
for helix in self.helices.values():
self._inline_deletions_insertions_on_helix(helix)
def _inline_deletions_insertions_on_helix(self, helix: Helix) -> None:
###################################################
# first gather information before changing anything
# gather all mods on helix
deletions = [deletion for domain in helix.domains for deletion in domain.deletions]
insertions = [insertion for domain in helix.domains for insertion in domain.insertions]
# change max offset
delta_length = sum(length for (offset, length) in insertions) - len(deletions)
# combined collection of deletions/insertions into one dict mapping offset --> None/len, where
# value of -1 indicates deletion, and otherwise is length of insertion
dels_ins = dict()
for deletion in deletions:
dels_ins[deletion] = -1
for insertion in insertions:
dels_ins[insertion[0]] = insertion[1]
# put offsets in sorted order
dels_ins_offsets_sorted = sorted(dels_ins.keys())
# fix helix major ticks
group = self.groups[helix.group]
major_ticks = sorted(helix.calculate_major_ticks(group.grid))
###################################################
# now that info is gathered, start changing things
if helix.max_offset is not None:
helix.max_offset += delta_length
if len(major_ticks) > 0:
major_tick_idx = 0
delta_acc = 0 # accumulated delta; insertions add to this and deletions subtract from it
for offset in dels_ins_offsets_sorted:
# go to first major tick great than offset, updating passed ones by delta_acc
while major_tick_idx < len(major_ticks) and major_ticks[major_tick_idx] <= offset:
major_ticks[major_tick_idx] += delta_acc
major_tick_idx += 1
delta_acc += dels_ins[offset]
# if necessary, update major ticks beyond last ins/del
while major_tick_idx < len(major_ticks):
major_ticks[major_tick_idx] += delta_acc
major_tick_idx += 1
# TODO: check if regularly spaced and reaching both ends, and if so set helix.major_tick_distance
helix.major_ticks = major_ticks
# fix domain start/end offsets
domains = sorted(helix.domains, key=lambda domain: domain.start)
delta_acc = 0
for domain in domains:
domain.start += delta_acc
delta_acc += domain.dna_length() - domain.visual_length()
domain.end += delta_acc
domain.deletions = []
domain.insertions = []
[docs]
def reverse_all(self) -> None:
"""
Reverses "polarity" of every :any:`Strand` in this :any:`Design`.
No attempt is made to make any assigned DNA sequences match by reversing or rearranging them.
Every :any:`Strand` keeps the same DNA sequence it had before (unreversed), if one was assigned.
It is recommended to assign/reassign DNA sequences *after* doing this operation.
"""
for strand in self.strands:
strand.reverse()
def set_major_tick_distance(self, major_tick_distance: int) -> None:
for helix in self.helices.values():
helix.major_tick_distance = major_tick_distance
def _ensure_helices_distinct_objects(self) -> None:
pair = _find_index_pair_same_object(self.helices)
if pair is not None:
i, j = pair
raise IllegalDesignError(
f"helices must all be distinct objects, but those at indices {i} and {j} are the same object"
)
def _ensure_strands_distinct_objects(self) -> None:
pair = _find_index_pair_same_object(self.strands)
if pair is not None:
i, j = pair
raise IllegalDesignError(
f"strands must all be distinct objects, but those at indices {i} and {j} are the same object"
)
def _ensure_helix_groups_exist(self) -> None:
for helix in self.helices.values():
if helix.group not in self.groups.keys():
raise IllegalDesignError(
f"helix {helix.idx} has group {helix.group}, which does not "
f"exist in the design. The valid groups are "
f"{', '.join(self.groups.keys())}"
)
def _has_default_groups(self) -> bool:
if not (len(self.groups) == 1 and default_group_name in self.groups):
return False
# even if there's only one group and it has the default name,
# need to check its fields for non-default values
group = self.groups[default_group_name]
return group.has_default_position_and_orientation()
def _assign_default_helices_view_orders_to_groups(self) -> None:
for name, group in self.groups.items():
if group.helices_view_order is None:
helices_in_group = {idx: helix for idx, helix in self.helices.items() if helix.group == name}
group._assign_default_helices_view_order(helices_in_group) # noqa
def _warn_if_strand_names_not_unique(self) -> None:
names = [strand.name for strand in self.strands if strand.name is not None]
if len(names) > len(set(names)):
for name1, name2 in itertools.combinations(names, 2):
if name1 == name2:
print(f"WARNING: there are two strands with name {name1}")
[docs]
def strand_with_name(self, name: str) -> Strand | None:
"""
:param name: name of a :any:`Strand`.
:return: the :any:`Strand` with name `name`, or None if no :any:`Strand` in the :any:`Design` has
that name.
"""
for strand in self.strands:
if strand.name == name:
return strand
return None
[docs]
def add_helix(self, idx: int, helix: Helix) -> None:
"""
Adds `helix` as a new :any:`Helix` with index `idx` to this Design.
:param idx:
index of new :any:`Helix`
:param helix:
the new :any:`Helix`
"""
if idx in self.helices:
raise ValueError(f"there is already a helix with idx = {idx} in this design:\n{self.helices[idx]}")
if helix.group not in self.groups:
raise ValueError(
f"Helix group is {helix.group} but this design has no group with that name:\n"
f"existing groups = {', '.join(self.groups.keys())}"
)
self.helices[idx] = helix
group = self.groups[helix.group]
group.helices_view_order.append(idx)
self._ensure_helices_distinct_objects()
self._set_helices_grid_positions_or_positions()
self._assign_default_helices_view_orders_to_groups()
[docs]
def relax_helix_rolls(self) -> None:
"""
Sets all helix rolls to "relax" them based on their crossovers.
This calculates the "strain" of each crossover c as the absolute value d_c of the distance between
the angle to the helix to which it is connected and the angle of that crossover given the
current helix roll. It minimizes sum_c d_c^2, i.e., minimize the sum of the squares of the strains.
"""
for helix in self.helices.values():
helix_group = self.groups[helix.group]
helix.relax_roll(self.helices, helix_group.grid, self.geometry)
# Copied from cadnano2
# honeycomb - https://github.com/douglaslab/cadnano2/blob/239ecc851407b64b44a8a4bdecdd5eb4848868f5/cadnano2/model/parts/honeycombpart.py#L44C1-L50C14
# square - https://github.com/douglaslab/cadnano2/blob/239ecc851407b64b44a8a4bdecdd5eb4848868f5/cadnano2/model/parts/squarepart.py#L37C1-L43C14
def is_even_parity(self, row: int, column: int) -> bool:
return (row % 2) == (column % 2)
def is_odd_parity(self, row: int, column: int) -> bool:
return bool((row % 2) ^ (column % 2))
[docs]
def get_helix_neighbors(self, helix: Helix) -> list[Helix]:
"""
returns the list of neighboring helices based on parity of an
input virtualHelix
If a potential neighbor doesn't exist, None is returned in it's place
NOTE: This function was translated from cadnano2's getVirtualHelixNeighbors (honeycombpart.py and part.py)
honeycomb - https://github.com/douglaslab/cadnano2/blob/239ecc851407b64b44a8a4bdecdd5eb4848868f5/cadnano2/model/parts/honeycombpart.py#L52C1-L79C14
square - https://github.com/douglaslab/cadnano2/blob/239ecc851407b64b44a8a4bdecdd5eb4848868f5/cadnano2/model/parts/squarepart.py#L45C1-L74C14
"""
neighbors = []
(c, r) = helix.grid_position
helices_by_coords = {}
for helix in self.helices.values():
(temp_col, temp_row) = helix.grid_position
helices_by_coords[(temp_row, temp_col)] = helix
# Simple sequential neighbor assumption
# Adjust this based on your actual helix layout
if self.is_even_parity(r, c): # Even parity
# squarepart.py in cadnano2 (getVirtualHelixNeighbors)
if self.grid == Grid.square:
neighbors.append(helices_by_coords.get((r, c + 1)))
neighbors.append(helices_by_coords.get((r + 1, c)))
neighbors.append(helices_by_coords.get((r, c - 1)))
neighbors.append(helices_by_coords.get((r - 1, c)))
# honeycombpart.py in cadnano2 (getVirtualHelixNeighbors)
elif self.grid == Grid.honeycomb:
neighbors.append(helices_by_coords.get((r, c + 1)))
neighbors.append(helices_by_coords.get((r - 1, c)))
neighbors.append(helices_by_coords.get((r, c - 1)))
else:
raise ValueError(f"Invalid grid type: {self.grid}")
else: # Odd parity
if self.grid == Grid.square:
neighbors.append(helices_by_coords.get((r, c - 1)))
neighbors.append(helices_by_coords.get((r - 1, c)))
neighbors.append(helices_by_coords.get((r, c + 1)))
neighbors.append(helices_by_coords.get((r + 1, c)))
elif self.grid == Grid.honeycomb:
neighbors.append(helices_by_coords.get((r, c - 1)))
neighbors.append(helices_by_coords.get((r + 1, c)))
neighbors.append(helices_by_coords.get((r, c + 1)))
else:
raise ValueError(f"Invalid grid type: {self.grid}")
return neighbors
def _hasNoStrandAtOrNoXover(self, domains: list[Domain], idx: int) -> bool:
"""
NOTE: Translated from cadnano2's hasStrandAtAndNoXover (strandset.py)
https://github.com/douglaslab/cadnano2/blob/239ecc851407b64b44a8a4bdecdd5eb4848868f5/cadnano2/model/strandset.py#L355C1-L366C14
"""
qStrand = Domain(domains[0].helix, forward=True, start=idx, end=idx + 1)
domainList = [d for d in qStrand.find_overlapping_ranges(domains)]
if len(domainList) > 0:
return False if domainList[0].has_crossover_at(idx) else True
else:
return True
[docs]
def get_crossover_points(self):
"""
Referenced from cadnano2's "Crossover" class within squarepart.py and honeycombpart.py
:returns: A tuple containing the list of crossover points for the specific grid type.
"""
# These numbers are directly referenced in cadnano2
# honeycomb - https://github.com/douglaslab/cadnano2/blob/239ecc851407b64b44a8a4bdecdd5eb4848868f5/cadnano2/model/parts/honeycombpart.py#L9C1-L13C41
# square - https://github.com/douglaslab/cadnano2/blob/239ecc851407b64b44a8a4bdecdd5eb4848868f5/cadnano2/model/parts/squarepart.py#L6C1-L10C44
match self.grid:
case Grid.square:
scafL = [[4, 26, 15], [18, 28, 7], [10, 20, 31], [2, 12, 23]]
scafH = [[5, 27, 16], [19, 29, 8], [11, 21, 0], [3, 13, 24]]
stapL = [[31], [23], [15], [7]]
stapH = [[0], [24], [16], [8]]
case Grid.honeycomb:
scafL = [[1, 11], [8, 18], [4, 15]]
scafH = [[2, 12], [9, 19], [5, 16]]
stapL = [[6], [13], [20]]
stapH = [[7], [14], [0]]
case _:
raise ValueError(f"Unsupported grid type: {self.grid}")
return scafL, scafH, stapL, stapH
[docs]
def potential_crossover_list(
self, helix: Helix, idx=None
) -> list[tuple[Helix, int, Literal["scaffold", "staple"], bool]] | None:
"""
Returns a list of tuples
(neighborVirtualHelix, index, strandType, isLowIdx)
where:
neighborVirtualHelix is a virtualHelix neighbor of the arg virtualHelix
index is the index where a potential Xover might occur
strandType is from the enum (StrandType.Scaffold, StrandType.Staple)
isLowIdx is whether or not it's the at the low index (left in the Path
view) of a potential Xover site
NOTE: Translated from cadnano2's potentialCrossoverList (part.py)
https://github.com/douglaslab/cadnano2/blob/239ecc851407b64b44a8a4bdecdd5eb4848868f5/cadnano2/model/parts/part.py#L1083C1-L1158C14
"""
_scafL, _scafH, _stapL, _stapH = self.get_crossover_points()
vh = helix
ret = [] # LUT = Look Up Table
part = self
lutsNeighbor = list(zip(_scafL, _scafH, _stapL, _stapH))
sTs = ("scaffold", "staple")
numBases = vh.max_offset - 1 # cadnano is inclusive, scadnano exclusive, so we subtract 1
# create a range for the helical length dimension of the Part,
# incrementing by the lattice step size.
_step = 32 if self.grid == Grid.square else 21 # 32 in square, 21 in honeycomb
baseRange = list(range(0, numBases, _step))
if idx != None:
baseRange = [x for x in baseRange if x >= idx - 3 * _step and x <= idx + 2 * _step]
if vh is None:
return None
fromStapSS, fromScafSS = vh.get_strand_sets()
fromStrandSets = [fromScafSS, fromStapSS]
neighbors = self.get_helix_neighbors(vh)
for neighbor, lut in zip(neighbors, lutsNeighbor):
# if neighborIdx is None:
# continue
#
# Get neighbor as vh.
# neighbor = self.helices[neighborIdx]
if not neighbor:
continue
# now arrange again for iteration
# (_scafL[i], _scafH[i]), (_stapL[i], _stapH[i]) )
# so we can pair by StrandType
lutScaf = lut[0:2]
lutStap = lut[2:4]
lut = (lutScaf, lutStap)
toStapSS, toScafSS = neighbor.get_strand_sets()
toStrandSets = [toScafSS, toStapSS]
for fromSS, toSS, pts, st in zip(fromStrandSets, toStrandSets, lut, sTs):
# test each period of each lattice for each StrandType
for pt, isLowIdx in zip(pts, (True, False)):
for i, j in itertools.product(baseRange, pt):
index = i + j
if index < numBases:
if self._hasNoStrandAtOrNoXover(fromSS, index) and self._hasNoStrandAtOrNoXover(
toSS, index
):
ret.append((neighbor, index, st, isLowIdx))
# end if
# end if
# end for
# end for
# end for
# end for
return ret
def _get_domain_at(self, domains: list[Domain], idx: int) -> Domain | None:
"""
Gets the domain at the specific index given a list of domains.
:returns: The domain that overlaps with the index provider. None if no domain overlaps.
"""
for domain in domains:
if domain.start <= idx < domain.end:
return domain
return None
[docs]
def assign_dna_sequence(self, strand: Strand, forward: bool, helix_idx: int) -> None:
"""
Assigns the DNA sequence based on strand direction.
"""
helix = self.helices[helix_idx]
sequence = ""
for domain in helix.domains:
if forward and domain.forward:
continue
if not forward and not domain.forward:
continue
sequence += domain.dna_sequence
self.assign_dna(strand, sequence, False, None, False)
[docs]
def autostaple(self) -> None:
"""Autostaple does the following:
1. Clear existing staple strands by iterating over each strand
and calling RemoveStrandCommand on each. The next strand to remove
is always at index 0.
2. Create temporary strands that span regions where scaffold is present.
3. Determine where actual strands will go based on strand overlap with
prexovers.
4. Delete temporary strands and create new strands.
NOTE: Translated from cadnano2's autostaple (part.py)
https://github.com/douglaslab/cadnano2/blob/239ecc851407b64b44a8a4bdecdd5eb4848868f5/cadnano2/model/parts/part.py#L257C1-L407C14
"""
# Check if any strand anywhere has a loopout or extension
for strand in self.strands:
for domain in strand.domains:
if isinstance(domain, Loopout):
raise ValueError(
"Cannot check for crossover: strand contains a Loopout. "
"The has_crossover_at method does not support strands with loopouts."
)
if isinstance(domain, Extension):
raise ValueError(
"Cannot check for crossover: strand contains an Extension. "
"The has_crossover_at method does not support strands with extensions."
)
# helix + offset for deletions
# We want to keep track of the original deletions
deletions = {}
for vhidx, vh in self.helices.items():
for domain in vh.domains:
deletions.setdefault(domain.helix, []).extend(domain.deletions)
epDict = {} # keyed on StrandSet
# 1) Remove existing staple strands.
for s in list(self.strands):
if not s.is_scaffold:
self.remove_strand(s)
# 2) Create temporary strands.
for vhidx, vh in self.helices.items():
# Since we removed the staple strands, at this point all of the helices should only have "scaffold" domains.
segments = []
scafSS = vh.domains
for strand in scafSS:
# in cadnano, start, end may be 16,95 (inclusive, inclusive) but in scadnano, it is 16,96 (inclusive, exclusive)
lo = strand.start
hi = strand.end - 1 # exclusive end
if len(segments) == 0:
segments.append([lo, hi]) # insert 1st staple
elif segments[-1][1] == lo - 1:
segments[-1][1] = hi # extend
else:
segments.append([lo, hi]) # insert another strand
# At this point, we need to imagine each helix has a staple strand set.
epDict[vhidx] = []
for i in range(len(segments)):
lo, hi = segments[i]
epDict[vhidx].extend(segments[i])
is_forward = vhidx % 2 == 1
new_domain = Domain(helix=vhidx, forward=is_forward, start=lo, end=hi + 1)
new_strand = Strand(domains=[new_domain], is_scaffold=False)
self.add_strand(new_strand)
# 3) Determine where crossovers should be installed
for vhidx, vh in self.helices.items():
# Need the staple strands for THIS specific helix.
# Need the scaffold strands for THIS specific helix.
# Need a bool on whether or not the staple strand is forward (5 to 3)
# Need list of potential crossovers for THIS specific helix.
stapSS, scafSS = vh.get_strand_sets()
is5to3 = stapSS[0].is5to3()
potentialXovers = self.potential_crossover_list(vh)
for neighborVh, idx, strandType, isLowIdx in potentialXovers:
if strandType != "staple":
continue
if isLowIdx and is5to3:
domain = self._get_domain_at(stapSS, idx)
# Neighbor staple strand set
neighborSS, _ = neighborVh.get_strand_sets()
# neighborSS = [domain for domain in neighborVh.domains if (neighborVh.idx % 2 == 0 and not domain.forward) or (neighborVh.idx % 2 == 1 and domain.forward)]
nDomain = self._get_domain_at(neighborSS, idx)
if domain == None or nDomain == None:
continue
# check for bases on both strands at [idx-1:idx+3]
if not (domain.start < idx and domain.end - 1 > idx + 1):
continue
if not (nDomain.start < idx and nDomain.end - 1 > idx + 1):
continue
# cehck for nearby scaffold xovers
scafStrandL = self._get_domain_at(scafSS, idx - 4)
scafStrandH = self._get_domain_at(scafSS, idx + 5)
if scafStrandL:
if scafStrandL.has_crossover_at(idx - 4):
continue
if scafStrandH:
if scafStrandH.has_crossover_at(idx + 5):
continue
# disable edge xovers
scafStrandL1 = self._get_domain_at(scafSS, idx - 1)
scafStrandM = self._get_domain_at(scafSS, idx)
scafStrandH1 = self._get_domain_at(scafSS, idx + 1)
if scafStrandL1:
if scafStrandL1.has_crossover_at(idx - 1) and not self._get_domain_at(vh.domains, idx - 2):
continue
if scafStrandL1.has_crossover_at(idx - 2) and not self._get_domain_at(vh.domains, idx - 3):
continue
if scafStrandM:
if scafStrandM.has_crossover_at(idx - 1) and not self._get_domain_at(vh.domains, idx - 2):
continue
if scafStrandM.has_crossover_at(idx + 1) and not self._get_domain_at(vh.domains, idx + 2):
continue
if scafStrandH1:
if scafStrandH1.has_crossover_at(idx + 1) and not self._get_domain_at(vh.domains, idx + 2):
continue
if scafStrandH1.has_crossover_at(idx + 2) and not self._get_domain_at(vh.domains, idx + 3):
continue
epDict[vhidx].extend([idx, idx + 1])
epDict[neighborVh.idx].extend([idx, idx + 1])
# 4) Clear temporary staple strands
for s in list(self.strands):
if not s.is_scaffold:
self.remove_strand(s)
#
# # 5) AutoStaple pt.1 (Breaking the strands)
for vhidx, epList in epDict.items():
assert len(epList) % 2 == 0
epList = sorted(epList)
ssIdx = 0
domains = []
is_forward = vhidx % 2 == 1 # since these are staple strands, we want them going opposite.
for i in range(0, len(epList), 2):
lo, hi = epList[i : i + 2]
domain = Domain(vhidx, forward=is_forward, start=lo, end=hi + 1)
domains.append(domain)
strand = Strand(domains=[domain], is_scaffold=False)
self.add_strand(strand)
self.assign_dna_sequence(strand, is_forward, vhidx)
ssIdx += 1
# 6) Create crossovers wherever possible.
for vhidx, vh in self.helices.items():
stapSS, _ = vh.get_strand_sets()
is5to3 = stapSS[0].is5to3()
potentialXovers = self.potential_crossover_list(vh)
for neighborVh, idx, strandType, isLowIdx in potentialXovers:
if strandType != "staple":
continue
# if (isLowIdx and is5to3):
if (isLowIdx and is5to3) or (not isLowIdx and not is5to3):
domain = self._get_domain_at(stapSS, idx)
neighborSS, _ = neighborVh.get_strand_sets()
# neighborSS = [domain for domain in neighborVh.domains if
# (neighborVh.idx % 2 == 0 and not domain.forward) or (neighborVh.idx % 2 == 1 and domain.forward)]
nDomain = self._get_domain_at(neighborSS, idx)
if domain is None or nDomain is None:
continue
if idx in [domain.start, domain.end - 1] and idx in [nDomain.start, nDomain.end - 1]:
# only install xovers on pre-split strands
self.add_half_crossover(
vhidx,
neighborVh.idx,
offset=idx,
forward=not self.helix_is_even_parity(vhidx),
offset2=idx,
forward2=self.helix_is_even_parity(vhidx),
)
self.add_half_crossover(
vhidx,
neighborVh.idx,
offset=idx + 1,
forward=not self.helix_is_even_parity(vhidx),
offset2=idx + 1,
forward2=self.helix_is_even_parity(vhidx),
)
# Re-Add Original Deletions
for vhidx, deletionIndices in deletions.items():
for deletionIdx in deletionIndices:
self.add_deletion(vhidx, deletionIdx)
[docs]
def helix_is_even_parity(self, helix_or_idx: Helix | int) -> bool:
"""Get parity from grid position, not helix index"""
if isinstance(helix_or_idx, int):
helix = self.helices[helix_or_idx]
else:
helix = helix_or_idx
if helix.grid_position is None:
return helix.idx % 2 == 0
(c, r) = helix.grid_position
return self.is_even_parity(r, c)
def _find_index_pair_same_object(elts: list | dict) -> tuple | None:
# return pair of indices representing same object in elts, or None if they do not exist
# input can be list or dict; if dict, returns pair of keys mapping to same object
if isinstance(elts, list):
elts = dict(enumerate(elts))
for i, j in itertools.combinations(elts.keys(), 2):
if elts[i] is elts[j]:
return i, j
return None
def _name_of_this_script() -> str:
"""Return name of the currently running script, WITHOUT the .py extension."""
return os.path.basename(sys.argv[0])[:-3]
[docs]
def write_file_same_name_as_running_python_script(
contents: str, extension: str, directory: str = ".", filename: str | None = None, add_extension: bool = False
) -> None:
"""
Writes a text file with `contents` whose name is (by default) the same as the name of the
currently running script, but with extension ``.py`` changed to `extension`.
:param contents:
contents of file to write
:param extension:
extension to use
:param directory:
directory in which to write file. If not specified, the current working directory is used.
:param add_extension:
whether to replace `.py` with `extension`
:param filename:
filename to use instead of the currently running script
"""
relative_filename = _get_filename_same_name_as_running_python_script(
directory, extension, filename, add_extension=add_extension
)
with open(relative_filename, "w") as out_file:
out_file.write(contents)
def _get_filename_same_name_as_running_python_script(
directory: str, extension: str, filename: str | None, add_extension: bool = False
) -> str:
# if filename is not None, assume it has an extension
if filename is None:
filename = _name_of_this_script() + "." + extension
elif add_extension:
filename += "." + extension
relative_filename = _create_directory_and_set_filename(directory, filename)
return relative_filename
def _create_directory_and_set_filename(directory: str, filename: str) -> str:
if not os.path.exists(directory):
os.makedirs(directory)
relative_filename = os.path.join(directory, filename)
return relative_filename
@dataclass(frozen=True)
class _OxdnaVector:
x: float = 0
y: float = 0
z: float = 0
def dot(self, other: "_OxdnaVector") -> float:
return self.x * other.x + self.y * other.y + self.z * other.z
def cross(self, other: "_OxdnaVector") -> "_OxdnaVector":
x = self.y * other.z - self.z * other.y
y = self.z * other.x - self.x * other.z
z = self.x * other.y - self.y * other.x
return _OxdnaVector(x, y, z)
def length(self) -> float:
return sqrt(self.x * self.x + self.y * self.y + self.z * self.z)
def normalize(self) -> "_OxdnaVector":
length = self.length()
return _OxdnaVector(self.x / length, self.y / length, self.z / length)
# returns a vector containing the min x, y, and z coords from both self and other
def coord_min(self, other: "_OxdnaVector") -> "_OxdnaVector":
return _OxdnaVector(min(self.x, other.x), min(self.y, other.y), min(self.z, other.z))
def coord_max(self, other: "_OxdnaVector") -> "_OxdnaVector":
return _OxdnaVector(max(self.x, other.x), max(self.y, other.y), max(self.z, other.z))
def __add__(self, other: "_OxdnaVector") -> "_OxdnaVector":
return _OxdnaVector(self.x + other.x, self.y + other.y, self.z + other.z)
def __sub__(self, other: "_OxdnaVector") -> "_OxdnaVector":
return _OxdnaVector(self.x - other.x, self.y - other.y, self.z - other.z)
def __mul__(self, scalar: float) -> "_OxdnaVector":
return _OxdnaVector(self.x * scalar, self.y * scalar, self.z * scalar)
def __rmul__(self, scalar: float) -> "_OxdnaVector":
return _OxdnaVector(self.x * scalar, self.y * scalar, self.z * scalar)
def __neg__(self) -> "_OxdnaVector":
return _OxdnaVector(-self.x, -self.y, -self.z)
def __str__(self) -> str:
return "({}, {}, {})".format(self.x, self.y, self.z)
def __repr__(self) -> str:
return "_OxdnaVector({}, {}, {})".format(self.x, self.y, self.z)
def __iter__(self) -> Iterator[float]:
yield self.x
yield self.y
yield self.z
# counterclockwise rotation around axis
# units of angle is degrees
def rotate(self, angle: float, axis: "_OxdnaVector") -> "_OxdnaVector":
u = axis.normalize()
c = cos(angle * pi / 180)
s = sin(angle * pi / 180)
return u * self.dot(u) + (c * u.cross(self)).cross(u) - s * u.cross(self)
# Constants related to oxdna export
_GROOVE_GAMMA = 20
_BASE_DIST = 0.6
_OXDNA_ORIGIN = _OxdnaVector(0, 0, 0)
# r, b, and n represent the oxDNA configuration (.dat) file vectors that describe a nucleotide
# r is the position of the base
# b is the backbone-base vector (in documentation as versor: more info on versors here https://eater.net/quaternions)
# n is the forward direction of the helix
@dataclass(frozen=True)
class _OxdnaNucleotide:
center: _OxdnaVector
# center of the slice of the helix to which this nucleotide belongs
normal: _OxdnaVector
# unit vector from the backbone to the center of the helix, same as negated b from oxDNA dat file
forward: _OxdnaVector
# unit vector pointing in direction from 3' to 5' ends of the helix, same as oxDNA n vector
base: str
v: _OxdnaVector = field(init=False, default=_OXDNA_ORIGIN) # velocity for oxDNA dat file
L: _OxdnaVector = field(init=False, default=_OXDNA_ORIGIN) # angular velocity for oxDNA dat file
# https://dna.physics.ox.ac.uk/index.php/Documentation
# r, b, and n represent the oxDNA dat file vectors that describe a nucleotide
# r is the position of the center of mass of the oxDNA binding sites
# (stacking, hydrogen bonding, backbone-repulsion https://dna.physics.ox.ac.uk/index.php/Documentation)
# offset from the center of the helix by _BASE_DIST
@property
def r(self) -> _OxdnaVector:
return self.center - self.b * _BASE_DIST
# b is the backbone-base vector (in documentation as versor: more info on versors here https://eater.net/quaternions)
@property
def b(self) -> _OxdnaVector:
return -self.normal
# n is the forward direction of the helix
@property
def n(self) -> _OxdnaVector:
return self.forward
@dataclass(frozen=True)
class _OxdnaStrand:
nucleotides: list[_OxdnaNucleotide] = field(default_factory=list)
def join(self, other: "_OxdnaStrand") -> "_OxdnaStrand":
return _OxdnaStrand(self.nucleotides + other.nucleotides)
# represents an oxDNA system and contains a list of strands
# from its list of strands it can compute the oxDNA conf and top files
@dataclass(frozen=True)
class _OxdnaSystem:
strands: list[_OxdnaStrand] = field(default_factory=list)
def compute_bounding_box(self, cubic: bool = True) -> _OxdnaVector:
min_vec = None
max_vec = None
for strand in self.strands:
for nuc in strand.nucleotides:
if min_vec is None:
min_vec = nuc.center
max_vec = nuc.center
else:
min_vec = min_vec.coord_min(nuc.center)
max_vec = max_vec.coord_max(nuc.center)
if min_vec is not None and max_vec is not None:
# 5 is arbitrarily chosen so that the box has a bit of wiggle room
# 1.5 multiplier is to make all crossovers appear (advice from Oxdna authors)
box = 1.5 * (max_vec - min_vec + _OxdnaVector(5, 5, 5))
if cubic: # oxDNA requires cubic bounding box with default simulation options
max_side = max(box.x, box.y, box.z)
box = _OxdnaVector(max_side, max_side, max_side)
return box
else:
return _OxdnaVector(1, 1, 1)
def ox_dna_output(self) -> tuple[str, str]:
bbox = self.compute_bounding_box()
dat_list = [f"t = 0\nb = {bbox.x} {bbox.y} {bbox.z}\nE = 0 0 0"]
top_list = []
nuc_count = 0
strand_count = 0
for strand in self.strands:
strand_count += 1
nuc_index = 0
for nuc in strand.nucleotides:
n5 = nuc_count - 1
n3 = nuc_count + 1
nuc_count += 1
if nuc_index == 0:
n5 = -1
if nuc_index == len(strand.nucleotides) - 1:
n3 = -1
nuc_index += 1
top_list.append(f"{strand_count} {nuc.base} {n3} {n5}")
dat_list.append(
f"{nuc.r.x} {nuc.r.y} {nuc.r.z} "
+ f"{nuc.b.x} {nuc.b.y} {nuc.b.z} "
+ f"{nuc.n.x} {nuc.n.y} {nuc.n.z} "
+ f"{nuc.v.x} {nuc.v.y} {nuc.v.z} "
+ f"{nuc.L.x} {nuc.L.y} {nuc.L.z}"
)
top = "\n".join(top_list) + "\n"
dat = "\n".join(dat_list) + "\n"
top = f"{nuc_count} {strand_count}\n" + top
return dat, top
NM_TO_OX_UNITS = 1.0 / 0.8518
# returns the origin, forward, and normal vectors of a helix
def _oxdna_get_helix_vectors(design: Design, helix: Helix) -> tuple[_OxdnaVector, _OxdnaVector, _OxdnaVector]:
"""
:param helix: Helix whose vectors we are getting
:return: return tuple (origin, forward, normal)
origin -- the starting point of the center of a helix, assumed to be at offset 0
forward -- the direction in which the helix propagates
normal -- a direction perpendicular to forward which represents the angle to the backbone at offset 0
for the forward Domain on the Helix.
"""
group = design.groups[helix.group]
grid = group.grid
geometry = design.geometry if group.geometry is None else group.geometry
# principal axes for computing rotation
# see https://en.wikipedia.org/wiki/Aircraft_principal_axes
yaw_axis = _OxdnaVector(0, 1, 0)
pitch_axis = _OxdnaVector(1, 0, 0)
roll_axis = _OxdnaVector(0, 0, 1)
# we apply rotations in the order yaw, pitch, and then roll
# first the yaw rotation
pitch_axis = pitch_axis.rotate(-design.yaw_of_helix(helix), yaw_axis)
roll_axis = roll_axis.rotate(-design.yaw_of_helix(helix), yaw_axis)
# then the pitch rotation
yaw_axis = yaw_axis.rotate(design.pitch_of_helix(helix), pitch_axis)
roll_axis = roll_axis.rotate(design.pitch_of_helix(helix), pitch_axis)
# then the roll rotation
# note only the group's roll is used here helix rolls are accounted for below
yaw_axis = yaw_axis.rotate(-group.roll, roll_axis)
pitch_axis = pitch_axis.rotate(-group.roll, roll_axis)
# by chosen convension, forward is the same as the roll axis
# and normal is the negated yaw axis
forward = roll_axis
normal = -yaw_axis
normal = normal.rotate(-helix.roll, roll_axis) # account for helix roll separately
# get the position of the helix within the group
position_in_helix_group = origin
if grid == Grid.none:
if helix.position is not None:
position_in_helix_group = helix.position
else:
if helix.grid_position is None:
raise AssertionError("helix.grid_position should be assigned if grid is not Grid.none")
position_in_helix_group = grid_position_to_position(helix.grid_position, grid, geometry)
# helix's position in it's group rotated so that it exists in the global rotation
position_in_helix_group_rotated = (
(pitch_axis * position_in_helix_group.x)
+ (yaw_axis * position_in_helix_group.y)
+ (roll_axis * position_in_helix_group.z)
)
# offset of helix group origin with respect to global coordinates
helix_group_offset = _OxdnaVector(group.position.x, group.position.y, group.position.z)
origin_ = (position_in_helix_group_rotated + helix_group_offset) * NM_TO_OX_UNITS
return origin_, forward, normal
[docs]
def grid_position_to_position(grid_position: tuple[int, int], grid: Grid, geometry: Geometry) -> Position3D:
"""
Converts a grid position to a 3D position (a :any:`Position3D`).
:param grid_position:
pair of ints representing a grid position
:param grid:
the :any:`Grid`; cannot be :data:`Grid.none`
:param geometry:
the :any:`Geometry` object defining spacing parameters between grid positions
:return:
the :any:`Position3D` represented by `grid_position` in the grid `grid`;
Note that the :data:`Position3D.z` coordinate is always 0.
"""
# see here for other instances of this conversion algorithm:
# https://github.com/UC-Davis-molecular-computing/scadnano/blob/985e2ebced188cc7d867a7cc695ba128fef86a87/lib/src/util.dart#L785
# https://github.com/UC-Davis-molecular-computing/scadnano/blob/985e2ebced188cc7d867a7cc695ba128fef86a87/lib/src/util.dart#L878
h, v = grid_position
if grid == Grid.square:
x = h * geometry.distance_between_helices()
y = v * geometry.distance_between_helices()
elif grid == Grid.hex:
x = (h + (v % 2) / 2) * geometry.distance_between_helices()
y = v * sqrt(3) / 2 * geometry.distance_between_helices()
elif grid == Grid.honeycomb:
x = h * sqrt(3) / 2 * geometry.distance_between_helices()
if h % 2 == 0:
y = (v * 3 + (v % 2)) / 2 * geometry.distance_between_helices()
else:
y = (v * 3 - (v % 2) + 1) / 2 * geometry.distance_between_helices()
else:
raise ValueError(f"grid must be square, hex, or honeycomb to interpret grid_position, but it is {grid}")
z = 0
return Position3D(x, y, z)
# if no sequence exists on a domain, generate one
def _oxdna_random_sequence(length: int) -> str:
bases = "ACGT"
seq = ""
for i in range(length):
seq += bases[randint(0, 3)]
return seq
def get_normal_vector_to(vec: _OxdnaVector) -> _OxdnaVector:
unit = _OxdnaVector(1, 0, 0)
normalized_vec = vec.normalize()
if 1 - abs(normalized_vec.dot(unit)) < 0.001:
unit = _OxdnaVector(0, 1, 0)
return unit.cross(vec)
def _convert_design_to_oxdna_system(design: Design) -> _OxdnaSystem:
system = _OxdnaSystem()
# each entry is the number of insertions - deletions since the start of a given helix
mod_map = {}
for idx, helix in design.helices.items():
if helix.max_offset is not None:
mod_map[idx] = [0] * (helix.max_offset - helix.min_offset)
else:
raise AssertionError("helix.max_offset should be non-None")
# insert each insertion / deletion as a postive / negative number
for strand in design.strands:
for domain in strand.domains:
if isinstance(domain, Domain):
helix = design.helices[domain.helix]
for ins_offset, ins_length in domain.insertions:
mod_map[domain.helix][ins_offset - helix.min_offset] = ins_length
for deletion in domain.deletions:
mod_map[domain.helix][deletion - helix.min_offset] = -1
# propagate the modifier so it stays consistent accross domains
for idx, helix in design.helices.items():
if helix.max_offset is not None:
for offset in range(helix.min_offset + 1, helix.max_offset):
mod_map[idx][offset] += mod_map[idx][offset - 1]
else:
raise AssertionError("helix.max_offset should be non-None")
# for efficiency just calculate each helix's vector once
helix_vectors = {idx: _oxdna_get_helix_vectors(design, helix) for idx, helix in design.helices.items()}
for strand in design.strands:
strand_domains: list[tuple[_OxdnaStrand, bool]] = []
for i, domain in enumerate(strand.domains):
ox_strand = _OxdnaStrand()
seq = domain.dna_sequence
if seq is None:
seq = "T" * domain.dna_length()
# handle normal domains
if isinstance(domain, Domain):
helix = design.helices[domain.helix]
group = design.groups[helix.group]
geometry = design.geometry if group.geometry is None else group.geometry
step_rot = -360 / geometry.bases_per_turn
origin_, forward, normal = helix_vectors[helix.idx]
if not domain.forward:
normal = normal.rotate(-geometry.minor_groove_angle, forward)
seq = seq[::-1] # reverse DNA sequence
# oxDNA will rotate our backbone vector by +- _GROOVE_GAMMA (20 degrees)
# we apply the opposite rotation so that we get the expected vector from scadnano in oxDNA
groove_gamma_correction = _GROOVE_GAMMA if domain.forward else -_GROOVE_GAMMA
normal = normal.rotate(groove_gamma_correction, forward).normalize()
# dict / set for insertions / deletions to make lookup cheaper when there are lots of them
deletions = set(domain.deletions)
insertions = dict(domain.insertions)
# use Design.geometry or HelixGroup.geometry field to figure out various distances
# https://github.com/UC-Davis-molecular-computing/scadnano/blob/master/lib/src/state/geometry.dart
# index is used for finding the base in our sequence
index = 0
for offset in range(domain.start, domain.end):
if offset not in deletions:
mod = mod_map[domain.helix][offset - helix.min_offset]
# we have to check insertions first because they affect the index
if offset in insertions:
num = insertions[offset]
for j in range(num):
cen = (
origin_
+ forward * (offset + mod - num + j) * geometry.rise_per_base_pair * NM_TO_OX_UNITS
)
norm = normal.rotate(step_rot * (offset + mod - num + j), forward)
# note oxDNA n vector points 3' to 5' opposite of scadnano forward vector
forw = -forward if domain.forward else forward
nuc = _OxdnaNucleotide(cen, norm, forw, seq[index])
ox_strand.nucleotides.append(nuc)
index += 1
cen = origin_ + forward * (offset + mod) * geometry.rise_per_base_pair * NM_TO_OX_UNITS
norm = normal.rotate(step_rot * (offset + mod), forward)
# note oxDNA n vector points 3' to 5' opposite of scadnano forward vector
forw = -forward if domain.forward else forward
nuc = _OxdnaNucleotide(cen, norm, forw, seq[index])
ox_strand.nucleotides.append(nuc)
index += 1
# strands are stored from 5' to 3' end
if not domain.forward:
ox_strand.nucleotides.reverse()
strand_domains.append((ox_strand, False))
# because we need to know the positions of nucleotides before and after the loopout
# we temporarily store domain strands with a boolean that is true if it's a loopout
# handle loopouts
elif isinstance(domain, Loopout):
# we place the loopout nucleotides at temporary nonsense positions and orientations
# these will be updated later, for now we just need the base
for base in seq:
center = _OxdnaVector()
normal = _OxdnaVector(0, -1, 0)
forward = _OxdnaVector(0, 0, 1)
nuc = _OxdnaNucleotide(center, normal, forward, base)
ox_strand.nucleotides.append(nuc)
strand_domains.append((ox_strand, True))
elif isinstance(domain, Extension):
is_5p = i == 0
helix = design.helices[domain.adjacent_domain().helix]
group = design.groups[helix.group]
geometry = design.geometry if group.geometry is None else group.geometry
nucleotides = _compute_extension_nucleotides(
design=design,
strand=strand,
is_5p=is_5p,
helix_vectors=helix_vectors,
mod_map=mod_map,
geometry=geometry,
)
ox_strand.nucleotides.extend(nucleotides)
strand_domains.append((ox_strand, False))
else:
raise ValueError(f"unsupported substrand type {domain}")
sstrand = _OxdnaStrand()
# process loopouts and join strands
for i in range(len(strand_domains)):
dstrand, is_loopout = strand_domains[i]
if is_loopout:
prev_nuc = strand_domains[i - 1][0].nucleotides[-1]
next_nuc = strand_domains[i + 1][0].nucleotides[0]
strand_length = len(dstrand.nucleotides)
# now we position loopouts relative to the previous and next strand
# for now we use a linear interpolation
forward = next_nuc.center - prev_nuc.center
normal = get_normal_vector_to(forward)
for loopout_idx in range(strand_length):
pos = prev_nuc.center + forward * ((loopout_idx + 1) / (strand_length + 1))
old_nuc = dstrand.nucleotides[loopout_idx]
new_nuc = _OxdnaNucleotide(pos, normal.normalize(), forward.normalize(), old_nuc.base)
dstrand.nucleotides[loopout_idx] = new_nuc
sstrand = sstrand.join(dstrand)
system.strands.append(sstrand)
return system
# FIXME: this is hacky and has some magic lines that I got by experimentation instead of understanding
def _compute_extension_nucleotides(
design: Design,
strand: Strand,
is_5p: bool,
helix_vectors: dict[int, tuple[_OxdnaVector, _OxdnaVector, _OxdnaVector]],
mod_map: dict[int, list[int]],
geometry: Geometry,
) -> list[_OxdnaNucleotide]:
step_rot = -360 / geometry.bases_per_turn
adj_dom = strand.domains[1] if is_5p else strand.domains[-2]
adj_helix = design.helices[adj_dom.helix]
offset = adj_dom.offset_5p() if is_5p else adj_dom.offset_3p() # offset of attached end of domain
origin_, forward, normal = helix_vectors[adj_dom.helix]
if not adj_dom.forward:
normal = normal.rotate(-geometry.minor_groove_angle, forward)
# oxDNA will rotate our backbone vector by +- _GROOVE_GAMMA (20 degrees)
# we apply the opposite rotation so that we get the expected vector from scadnano in oxDNA
groove_gamma_correction = _GROOVE_GAMMA if adj_dom.forward else -_GROOVE_GAMMA
normal = normal.rotate(groove_gamma_correction, forward).normalize()
# rotate normal by angle about the forward vector to get vector pointing at backbone at attached_offset
mod = mod_map[adj_dom.helix][offset - adj_helix.min_offset]
cen = origin_ + forward * (offset + mod) * geometry.rise_per_base_pair * NM_TO_OX_UNITS
norm = normal.rotate(step_rot * (offset + mod), forward)
# note oxDNA n vector points 3' to 5' opposite of scadnano forward vector
forw = -forward if adj_dom.forward else forward
ext = strand.domains[0] if is_5p else strand.domains[-1]
seq = ext.dna_sequence
if seq is None:
seq = "T" * ext.dna_length()
if is_5p:
seq = seq[::-1]
new_forw = norm
new_norm = forw
nucs = []
for base in seq:
cen += norm
nuc = _OxdnaNucleotide(cen, new_norm, new_forw, base)
nucs.append(nuc)
if is_5p:
nucs = nucs[::-1]
return nucs